View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4431-Insertion-8 (Length: 151)

Name: NF4431-Insertion-8
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4431-Insertion-8
NF4431-Insertion-8
[»] chr5 (1 HSPs)
chr5 (44-108)||(42121172-42121237)


Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.0000000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 44 - 108
Target Start/End: Complemental strand, 42121237 - 42121172
Alignment:
44 tgataattgtattggtagtgaccagataga-tatctaagatttattgtatactctagaatgttttg 108  Q
    |||||||||||||||| |||||||  ||   |||||||||||||||||||||||||||||||||||    
42121237 tgataattgtattggtggtgaccaactaatctatctaagatttattgtatactctagaatgttttg 42121172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University