View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4432-Insertion-13 (Length: 148)
Name: NF4432-Insertion-13
Description: NF4432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4432-Insertion-13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 1e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 7 - 148
Target Start/End: Complemental strand, 26595255 - 26595112
Alignment:
| Q |
7 |
acccttcacctaaactatatatccaaaacattttccttaaatcnnnnnnnnnnntt-ggttacttaagtcacacttttttgcttctagtgttcattt-ct |
104 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
26595255 |
acccctcacctaaactatatacccaaaacattttccttaaatcaaaaatatttttttggttacttaagtcacacttttttgcttctattgttcattttct |
26595156 |
T |
 |
| Q |
105 |
tttatttttggctttaatattcccatattaacatgatcatatag |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26595155 |
tttatttttggctttaatattcccatattaacatgatcatatag |
26595112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University