View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4432-Insertion-15 (Length: 103)
Name: NF4432-Insertion-15
Description: NF4432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4432-Insertion-15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 40769906 - 40769998
Alignment:
| Q |
8 |
aaactttgcagctgtctcctctaccttgtggatttcttcccctttttgagcttctatcattgcctttttctcttctgctgatttatgaatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40769906 |
aaactttgcagctgtctcctctaccttgaggatttcttcccctttttgagcttctatcattgcctttttctcttctgctgatttatgaatttc |
40769998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University