View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4432_high_10 (Length: 249)
Name: NF4432_high_10
Description: NF4432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4432_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 69 - 239
Target Start/End: Original strand, 50657920 - 50658090
Alignment:
| Q |
69 |
aaaacaatatcatgtcttatagttattagatcagtttttctcttttgtccgagtttaaactcaacaacttcaactccgtatcatttaacgcagaccaatt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
50657920 |
aaaacaatatcatgtcttatagttattagatcagtttttctcttttgtccgagtttaaactcaacaacttcaactccgtatcatttaacgcaaactaatt |
50658019 |
T |
 |
| Q |
169 |
gagctacccaacctcaataatatcatatctattgagaagatattttaacacattgttttctctctatctct |
239 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50658020 |
gagctacccaaccccaataatatcatgtctatcgagaagatattttaacacattgttttctctctatctct |
50658090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University