View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4433-Insertion-6 (Length: 312)
Name: NF4433-Insertion-6
Description: NF4433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4433-Insertion-6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 8 - 312
Target Start/End: Original strand, 26888929 - 26889233
Alignment:
| Q |
8 |
atattcctaacgaaatctcccgtttaactaaccttctcacattaaggcttcaaaacaatgcattctctggtaacatccctgacctctcttccgcaatgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26888929 |
atattcctaacgaaatctcccgtttaactaaccttctcacattaaggcttcagaacaacgcactctctggtaacatccctgacctctcttccattatgcc |
26889028 |
T |
|
| Q |
108 |
gaatctcacagagctcaacatgacaaacaatgaattatacggcaaagtaccaaacacaatgcttaacaaattcggagatgaaagtttctccggcaatgaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26889029 |
gaatctcacagagctcaacatgacaaacaatgaattctacggcaaagtaccgaacacaatgcttaacaaattcggagatgaaagcttctccggcaatgaa |
26889128 |
T |
|
| Q |
208 |
ggcttatgtggttcaaaacctttccaagtttgttccttaacagagaacagtcctccttcctctgaaccggttcagacagttccttcaaacccgagttctt |
307 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26889129 |
ggtttatgtggttcaaaacctttccaagtttgttccttaacagagaacagtcctccttcctctgaaccggttcagacagttccttcaaacccgagttctt |
26889228 |
T |
|
| Q |
308 |
tccct |
312 |
Q |
| |
|
||||| |
|
|
| T |
26889229 |
tccct |
26889233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University