View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4433_high_13 (Length: 250)
Name: NF4433_high_13
Description: NF4433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4433_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 133 - 243
Target Start/End: Original strand, 4692708 - 4692818
Alignment:
| Q |
133 |
atttgggacataaactgtgtacctgcattattacagattggtgtagtgtccaataattttctcatgtagattcttaaatattaattgttgtgactactct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4692708 |
atttgggacataaactgtgtacctgcattattacagattggtgtagtgtccaataattttctcatgtagattcttaaatattaattgttgtgactactct |
4692807 |
T |
|
| Q |
233 |
tacctatgctt |
243 |
Q |
| |
|
||||||||||| |
|
|
| T |
4692808 |
tacctatgctt |
4692818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 4692576 - 4692640
Alignment:
| Q |
1 |
acaatcaagatctgcttttctctttaattcaatttattgattgcagtctctttgtgtaattagca |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4692576 |
acaatcaagatctgcttttctctttaattcaatttattgattgcagtctctttgtgtaattagca |
4692640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University