View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4433_high_13 (Length: 250)

Name: NF4433_high_13
Description: NF4433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4433_high_13
NF4433_high_13
[»] chr8 (2 HSPs)
chr8 (133-243)||(4692708-4692818)
chr8 (1-65)||(4692576-4692640)


Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 133 - 243
Target Start/End: Original strand, 4692708 - 4692818
Alignment:
133 atttgggacataaactgtgtacctgcattattacagattggtgtagtgtccaataattttctcatgtagattcttaaatattaattgttgtgactactct 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4692708 atttgggacataaactgtgtacctgcattattacagattggtgtagtgtccaataattttctcatgtagattcttaaatattaattgttgtgactactct 4692807  T
233 tacctatgctt 243  Q
    |||||||||||    
4692808 tacctatgctt 4692818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 4692576 - 4692640
Alignment:
1 acaatcaagatctgcttttctctttaattcaatttattgattgcagtctctttgtgtaattagca 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4692576 acaatcaagatctgcttttctctttaattcaatttattgattgcagtctctttgtgtaattagca 4692640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University