View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4433_high_8 (Length: 284)
Name: NF4433_high_8
Description: NF4433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4433_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 268
Target Start/End: Complemental strand, 42423749 - 42423495
Alignment:
| Q |
14 |
caaaggctatggttgtgggtcgtttggctgattcaatcagagagatttctgggttacctgaatgtcaaaacgtttgtaagaagatgtatgggaatttgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42423749 |
caaaggctatggttgtgggtcgtttggctgattcaatcagagagatttctgggttacctgaatgtcaaaacgtttgtaagaagatgtatgggaatttgat |
42423650 |
T |
 |
| Q |
114 |
tcgtagggtgaagcttttgagtcctttgtttgaggaattgaaggattgtgacgagtcccttagtgatgaagagattgaagcttttgaatctttgagggtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42423649 |
tcgtagggtgaagcttttgagtcctttgtttgaggaattgaaggattgtgatgagtcccttagtgatgaagagattgaagcttttgaatctttgagggtt |
42423550 |
T |
 |
| Q |
214 |
gctttggatttgactatgattcttttgaagtctgttaatcatgggagtaagcttt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42423549 |
gctttggatttgactatgattcttttgaagtctgttaatcatgggagtaagcttt |
42423495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University