View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4433_low_13 (Length: 253)
Name: NF4433_low_13
Description: NF4433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4433_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 76 - 243
Target Start/End: Original strand, 43143494 - 43143661
Alignment:
| Q |
76 |
gaaacaaagtgtgacaatgaagcatagttagctatttgaattaagtcacaacattaattagagaacttttcatttaggcttttgataatgtatcattatt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143494 |
gaaacaaagtgtgacaatgaagcatagttagctatttgaattaagtcacaacattaattagagaacttttcatttaggcttttgataatgtatcattatt |
43143593 |
T |
 |
| Q |
176 |
aaaaagggttttattatatagccttgttcgatgggctttgacactagtggaagaacattctttctgtg |
243 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143594 |
aaaaagggttttattgtacagccttgttcgatgggctttgacactagtggaagaacattctttctgtg |
43143661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 43155707 - 43155764
Alignment:
| Q |
183 |
gttttattatatagccttgttcgatgggctttgacactagtggaagaacattctttct |
240 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
43155707 |
gttttattatacagccctgttcgatgggctttgccactggtggaagaacattctttct |
43155764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 182
Target Start/End: Original strand, 43155486 - 43155557
Alignment:
| Q |
111 |
ttgaattaagtcacaacattaattagagaacttttcatttaggcttttgataatgtatcattattaaaaagg |
182 |
Q |
| |
|
||||||||||| || |||||||||| ||||||| |||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
43155486 |
ttgaattaagttgcagtattaattagataactttttatttagacttttgatagtgtatcattatttaaaagg |
43155557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 43143436 - 43143467
Alignment:
| Q |
18 |
aatctctgtagcaacatatgagtttgagatag |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43143436 |
aatctctgtagcaacatatgagtttgagatag |
43143467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University