View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4435-Insertion-11 (Length: 132)
Name: NF4435-Insertion-11
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4435-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 2129010 - 2128886
Alignment:
| Q |
8 |
gatttcaaagctcaagtacttgttcctaacaccagggctgaagtcgaccttagttacggatgttcgaaagcattgtgattgaggggaatgcaaagaaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2129010 |
gatttcaaagctcaagtacttgttcctaacaccagggctgaagtcaaccttagttacggatgtttgaaagcattgtgattgaggggaatgcaaagaaaga |
2128911 |
T |
 |
| Q |
108 |
gacattcatcaaactacatatcttt |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2128910 |
gacattcatcaaactacatatcttt |
2128886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University