View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4435-Insertion-9 (Length: 212)
Name: NF4435-Insertion-9
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4435-Insertion-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 47225454 - 47225658
Alignment:
| Q |
8 |
ctttgtaccccactaaagatcatcaatttgcatgaaatgggtccagcctttccttgctttgctcatcatgtttttgctattgggatatgctttcaaagag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47225454 |
ctttgtaccccactaaagatcatcaatttgcatgaaatgggtccaacctttccttgctttgctcatcatgtttttgctattgggatatgctttcaaagag |
47225553 |
T |
 |
| Q |
108 |
cattatcttgtctcttagggttcannnnnnnaaatggttgtaaagcatggtggaaattttaggtttagttgtacaaggtggtaagggtatattggaatgt |
207 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47225554 |
cattatcttgtctcgtagggttcatttttttaaatggttgtaaagcatggtggaaattttaggtttagttgtacaaggtggtaagggtatattggaatgt |
47225653 |
T |
 |
| Q |
208 |
cttga |
212 |
Q |
| |
|
||||| |
|
|
| T |
47225654 |
cttga |
47225658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University