View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4435_high_6 (Length: 235)
Name: NF4435_high_6
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4435_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3015876 - 3015659
Alignment:
| Q |
1 |
aatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcatcaacaaacaaattcccattttctgctgctagctcatgcagcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015876 |
aatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcaccaacaaacaaattcccattttctgctgctagctcatgcagcatg |
3015777 |
T |
|
| Q |
101 |
ttccttgacatatcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgatgacgacgacgactttgaccttttaattctac |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
3015776 |
ttccttgacatttcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatgat---gatgacgactttgaccttttaattctac |
3015680 |
T |
|
| Q |
201 |
agaaacaagtgaggtagaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3015679 |
agaaacaagtgaggtagaatt |
3015659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University