View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4435_low_6 (Length: 256)
Name: NF4435_low_6
Description: NF4435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4435_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 71 - 240
Target Start/End: Complemental strand, 40069573 - 40069404
Alignment:
| Q |
71 |
agggagcattgcattaataatttttattatgcattactgcctataatatatatatttttatggaagtagcctgcaaatatgattgagttgaagttctcat |
170 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
40069573 |
agggagcattgtattaataatttttattatgcattactgcctataatatatatatttttatggaagtagcctacaaatatgattgagttgaacttctcat |
40069474 |
T |
|
| Q |
171 |
gcattctactagctagctggtatatgctgtttcatatcatatatgtaccgaagtctagtttaatggttat |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40069473 |
gcattctactagctagctggtatatgcagtttcatatcatatatgtaccgaagtctagtttaatggttat |
40069404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 10715793 - 10715825
Alignment:
| Q |
18 |
cattgcagggtgctacaaccactacaaacttag |
50 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
10715793 |
cattgcagggtgctacaactactacaaacttag |
10715825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University