View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4436-Insertion-20 (Length: 75)
Name: NF4436-Insertion-20
Description: NF4436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4436-Insertion-20 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 7 - 75
Target Start/End: Original strand, 5351544 - 5351612
Alignment:
| Q |
7 |
agatagaagggaattttccagctgaagttgaagcttttcgtcaaaagattcttgctgctgatagtgttc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5351544 |
agatagaagggaattttccagctgaagttgaagcttttcgtcaaaagattcttgctgctgatagtgttc |
5351612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 5325572 - 5325508
Alignment:
| Q |
11 |
agaagggaattttccagctgaagttgaagcttttcgtcaaaagattcttgctgctgatagtgttc |
75 |
Q |
| |
|
|||||| | |||||| |||||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
5325572 |
agaaggaacttttcctgctgaagttgaagcatttcgtcataagattcttgaagctgatagtgttc |
5325508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University