View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4436_low_14 (Length: 225)
Name: NF4436_low_14
Description: NF4436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4436_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 24 - 124
Target Start/End: Complemental strand, 8154027 - 8153927
Alignment:
| Q |
24 |
gttacagttacaagctgtagcatttgtgtctgttaaatacttacatttgaaataactttatttttattagattgccctgccgtttcgagaatcttggaat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8154027 |
gttacagttacaagctgtagcatttgtgtcttttgaatacttccatttgaaataactttatttttaatagattgccctgccgtttcgagaatcttggaat |
8153928 |
T |
 |
| Q |
124 |
a |
124 |
Q |
| |
|
| |
|
|
| T |
8153927 |
a |
8153927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University