View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4436_low_9 (Length: 249)
Name: NF4436_low_9
Description: NF4436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4436_low_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 26876651 - 26876882
Alignment:
| Q |
18 |
gtaaaaagatcccttttatacgttctattgttcttcttggattttgtaatgatgtgattagcgtaagagtcaatttgtttgtcaatggctgtgaatattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26876651 |
gtaaaaagatcccttttatacgttctattgttcttcttggattttgtaatgatgtgattaacgtaagagtcaatttgtttgtcaatggctgtgaatattg |
26876750 |
T |
 |
| Q |
118 |
tttgatgcgttgttgccctttccgctttgaaccgaatcatacatgtctatttgatttgggattggaagaaaatattagactatatagccaagattatccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26876751 |
tttgatgcgttgttgccctttccgctttgaaccgaatcatacatgtctatttgatttgagattggaagaaaatattagactatatagccaagattatccc |
26876850 |
T |
 |
| Q |
218 |
gggaaactcgtttgtgaactggaggaagtact |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26876851 |
gggaaactcgtttgtgaactggaggaagtact |
26876882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University