View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437-Insertion-7 (Length: 213)
Name: NF4437-Insertion-7
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 8 - 139
Target Start/End: Original strand, 14354738 - 14354867
Alignment:
| Q |
8 |
atatgtagcgaaatattgttcgggaaattttatgagtgttgttttgtgagttaaaaagcgaattgcagatcaggttttgtaactaagtctcatatcaccc |
107 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
14354738 |
atatgtagcaaaatattgttctggaaatttcatgagtgttgttttgtgagttaaaaagcaaattgcagattaggttttgtaactaag--tcatatcaccc |
14354835 |
T |
|
| Q |
108 |
cactaatgatgataaatagccaatcacatgta |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14354836 |
cactaatgatgataaatagccaatcacatgta |
14354867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 181 - 210
Target Start/End: Original strand, 18916001 - 18916030
Alignment:
| Q |
181 |
aagaatgacatttccgggaatacatggcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18916001 |
aagaatgacatttccgggaatacatggcta |
18916030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 181 - 210
Target Start/End: Original strand, 15805612 - 15805641
Alignment:
| Q |
181 |
aagaatgacatttccgggaatacatggcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15805612 |
aagaatgacatttccgggaatacatggcta |
15805641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 181 - 210
Target Start/End: Complemental strand, 32597705 - 32597676
Alignment:
| Q |
181 |
aagaatgacatttccgggaatacatggcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32597705 |
aagaatgacatttccgggaatacatggcta |
32597676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University