View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437_high_8 (Length: 316)
Name: NF4437_high_8
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 121 - 256
Target Start/End: Complemental strand, 9411150 - 9411015
Alignment:
| Q |
121 |
attaggcataaatcaatcaatttatataccatggcattgtcattaccgccaacaagctaccaagtttctaggaaactttctattatacgatgataaatca |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9411150 |
attaggcataaatcaatcattttatatactatggcattgtcattaccgccaacaagctaccaagtttctaggaaactttctattatacgatgataaatca |
9411051 |
T |
|
| Q |
221 |
ttagtggaaattaagcattgaatatcattttctctc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9411050 |
ttagtggaaattaagcattgaatatcattttctctc |
9411015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 15 - 124
Target Start/End: Complemental strand, 9411288 - 9411179
Alignment:
| Q |
15 |
acccaaaaccaaatcaaaattaaacacgagtcagctgtgtctattttattattaatccgataaacaattgtggtgtccatttataggccattagatattt |
114 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9411288 |
acccaaaaccaaatcaaaattaagcatgagtcagctgtgtctattttattattaatccgataaacaattgtggtgtccatttataggccattagatattt |
9411189 |
T |
|
| Q |
115 |
taatagatta |
124 |
Q |
| |
|
|||||||||| |
|
|
| T |
9411188 |
taatagatta |
9411179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Complemental strand, 9411003 - 9410974
Alignment:
| Q |
273 |
gcattgaatatcattttattgggtcatgac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9411003 |
gcattgaatatcattttattgggtcatgac |
9410974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University