View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437_low_10 (Length: 316)
Name: NF4437_low_10
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 5548914 - 5549197
Alignment:
| Q |
20 |
tacaaacacaccgcaaatgaatcaattatagcatttgcaaaattacgcaacaaagtgcacaaataataagcatatttactttgctatccatggctagcaa |
119 |
Q |
| |
|
||||||| || ||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
5548914 |
tacaaacccaacgcaaattaatcaattatagcatttgcaaaat-acgcaacaaagtgcacaaatagtaagcatatttacattgctatccatggctagcaa |
5549012 |
T |
 |
| Q |
120 |
agaattcaggttggtttcaccagcaattgacaaagaaggaggtgtcaaattaccaagatattacacacatgaaggtgtaggttcaaagtggaacatatct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
5549013 |
agaattcaggttggtttcaccagcaattgacaaagaaggaggtgtcaaattaccaagatattacacacatgaaggcgtaggttcaaagtggaatatatct |
5549112 |
T |
 |
| Q |
220 |
ccacctctagaatggcataacgttcctcccaaaaccaagagcctagctcttgtggtgcaggatgttgacaccctggatccaactg |
304 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
5549113 |
ccacctctagaatggcttaacgttcctcccaaaaccaagagcctagctcttttggtgcaggatgttgacaccgtggatccaactg |
5549197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University