View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437_low_11 (Length: 314)
Name: NF4437_low_11
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437_low_11 |
 |  |
|
| [»] scaffold0147 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 94 - 307
Target Start/End: Complemental strand, 20735 - 20522
Alignment:
| Q |
94 |
tttgtgtctctgttaggaaaatctgataatgattatgaaaaaagtaataagaatgggaatttgaagaagaaaattgatgaagtgggtgataatgaagagg |
193 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20735 |
tttgtgtctgtgttaggaaaatttgataatgattatgaaaaaagtaataagagtgggaatttgaagaagaaaattgatgaagtgggtgataatgaagagg |
20636 |
T |
 |
| Q |
194 |
agtttttacttgaagagtatgagagtgaagacgagggtagtagtggatcgtcgaagaggaaagcaagtaaaagtggttttagttctacgagtgaagacga |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20635 |
agtttttacttgaagagtatgagagtgaagacgagggtagtagtggagcgtcgaagaggaaagcaagtaaaagtggttttagttctacgagtgaagacga |
20536 |
T |
 |
| Q |
294 |
gtctggtgatgatg |
307 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20535 |
gtctggtgatgatg |
20522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 20828 - 20771
Alignment:
| Q |
1 |
caaggttcagatgatgaacctgattggatgagagattttgttgtcaacaataatcatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20828 |
caaggttcagatgatgaacctgattggatgagagattttgtggtcaacaataatcatc |
20771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University