View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4437_low_15 (Length: 257)

Name: NF4437_low_15
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4437_low_15
NF4437_low_15
[»] chr8 (1 HSPs)
chr8 (12-240)||(31935890-31936118)
[»] chr5 (1 HSPs)
chr5 (182-240)||(8810286-8810344)
[»] chr4 (1 HSPs)
chr4 (34-88)||(27975632-27975686)


Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 12 - 240
Target Start/End: Original strand, 31935890 - 31936118
Alignment:
12 atgaacctgaaccgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctagagtgaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31935890 atgaacctgaaccgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctagagtgaa 31935989  T
112 ttctgctaatgttgccggtggtgttgcaccgttaccgttgcagttaatttctccggaaccacagtcaccggttgagcaagttccgtgaccagaatcgtcg 211  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31935990 ttctgctaatgttgccggtggtgttgcaccgttaccattgcagttaatttctccggaaccacagtcaccggttgagcaagttccgtgaccagaatcgtcg 31936089  T
212 aatttgcaaccggttcttgcccagaatct 240  Q
    |||||||||||||||||||||||||||||    
31936090 aatttgcaaccggttcttgcccagaatct 31936118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 8810344 - 8810286
Alignment:
182 gttgagcaagttccgtgaccagaatcgtcgaatttgcaaccggttcttgcccagaatct 240  Q
    ||||||||||||||||| || || || ||||||| ||| ||||||||| ||||||||||    
8810344 gttgagcaagttccgtggccggagtcatcgaattggcagccggttcttccccagaatct 8810286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 88
Target Start/End: Original strand, 27975632 - 27975686
Alignment:
34 ttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatct 88  Q
    |||||| |||| |||||||||||||||||| |||||||| ||||| ||| |||||    
27975632 ttcaactatcatcggaagattgtaaccgtcgacgagactcacgtcgtagaaatct 27975686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University