View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437_low_15 (Length: 257)
Name: NF4437_low_15
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 12 - 240
Target Start/End: Original strand, 31935890 - 31936118
Alignment:
| Q |
12 |
atgaacctgaaccgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctagagtgaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935890 |
atgaacctgaaccgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctagagtgaa |
31935989 |
T |
 |
| Q |
112 |
ttctgctaatgttgccggtggtgttgcaccgttaccgttgcagttaatttctccggaaccacagtcaccggttgagcaagttccgtgaccagaatcgtcg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935990 |
ttctgctaatgttgccggtggtgttgcaccgttaccattgcagttaatttctccggaaccacagtcaccggttgagcaagttccgtgaccagaatcgtcg |
31936089 |
T |
 |
| Q |
212 |
aatttgcaaccggttcttgcccagaatct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31936090 |
aatttgcaaccggttcttgcccagaatct |
31936118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 8810344 - 8810286
Alignment:
| Q |
182 |
gttgagcaagttccgtgaccagaatcgtcgaatttgcaaccggttcttgcccagaatct |
240 |
Q |
| |
|
||||||||||||||||| || || || ||||||| ||| ||||||||| |||||||||| |
|
|
| T |
8810344 |
gttgagcaagttccgtggccggagtcatcgaattggcagccggttcttccccagaatct |
8810286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 88
Target Start/End: Original strand, 27975632 - 27975686
Alignment:
| Q |
34 |
ttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatct |
88 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
27975632 |
ttcaactatcatcggaagattgtaaccgtcgacgagactcacgtcgtagaaatct |
27975686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University