View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437_low_16 (Length: 245)
Name: NF4437_low_16
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9411255 - 9411477
Alignment:
| Q |
1 |
ctgactcatgcttaattttgatttggttttgggtaattttaaaaactttgatttagaatgtttaaatgtttaattagctggatcaagctaaaggcacgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9411255 |
ctgactcatgcttaattttgatttggttttgggtaattttaaaaagtttgatttagaatgtttaaatgtttaattagctggatcaagctaaaggcacgaa |
9411354 |
T |
|
| Q |
101 |
cctttccgaactctatagaagcaaaatattgtctccagcatatgaaatcagaattatataatttaaattgttaggagttggtgatcaagcaatttatata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9411355 |
cctttccgaactctatagaagcaaaatattgtctccaccatatgaaatcagaattatataatttaaattgttaggagttggtgatcaagcaattcatata |
9411454 |
T |
|
| Q |
201 |
aattgttgttcaatcatatcttt |
223 |
Q |
| |
|
||||| | |||||| |||||||| |
|
|
| T |
9411455 |
aattgctattcaattatatcttt |
9411477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University