View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4437_low_5 (Length: 438)
Name: NF4437_low_5
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4437_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 122 - 429
Target Start/End: Original strand, 3959556 - 3959863
Alignment:
| Q |
122 |
agacaccaacatgttggtttgtagtttgccaaaaatatatgccccttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959556 |
agacaccaacatgttggtttgtagtttgccaaaaatatatgccccttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaac |
3959655 |
T |
 |
| Q |
222 |
cccaatgaggtggtccagaatttttcgttcattcatgtttggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagca |
321 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3959656 |
cccaatgatgtggtccagaattttttgttcattcatgtatggaaacccgaatgactataataaccgctagaaaccctttacaatgtggaaattggcagca |
3959755 |
T |
 |
| Q |
322 |
aaacattggtttcaaaattattttggtacatatatatgccctttatcgttggtgaaacttatagagtaaatatatcccttcttttctgctcctaattctc |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959756 |
aaacattggtttcaaaattattttggtacatatatatgccctttatcgttggtgaaacttatatagtaaatatatcccttcttttctgctcctaattctc |
3959855 |
T |
 |
| Q |
422 |
ttatgtct |
429 |
Q |
| |
|
|||||||| |
|
|
| T |
3959856 |
ttatgtct |
3959863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 3958473 - 3958558
Alignment:
| Q |
18 |
ccttcttgattaaaattaaggctataggacaaggacgtgaaaggtaatcgtaagttgtaggttatctttaactttcttctttaaatgagaac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3958473 |
ccttcttgattaaaattaaggctatagga------cgtgaaaggtaatcgtaagttgtaggttatctttaactttcttctttaaatgagaac |
3958558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 261 - 326
Target Start/End: Complemental strand, 4021260 - 4021195
Alignment:
| Q |
261 |
tggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaaca |
326 |
Q |
| |
|
||||||||| ||||||| ||| |||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4021260 |
tggaaaccctaatgactctaacaaccaccagaaacccttcaggttgtggaaattggcagcaaaaca |
4021195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University