View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4437_low_9 (Length: 316)

Name: NF4437_low_9
Description: NF4437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4437_low_9
NF4437_low_9
[»] chr8 (3 HSPs)
chr8 (121-256)||(9411015-9411150)
chr8 (15-124)||(9411179-9411288)
chr8 (273-302)||(9410974-9411003)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 121 - 256
Target Start/End: Complemental strand, 9411150 - 9411015
Alignment:
121 attaggcataaatcaatcaatttatataccatggcattgtcattaccgccaacaagctaccaagtttctaggaaactttctattatacgatgataaatca 220  Q
    ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9411150 attaggcataaatcaatcattttatatactatggcattgtcattaccgccaacaagctaccaagtttctaggaaactttctattatacgatgataaatca 9411051  T
221 ttagtggaaattaagcattgaatatcattttctctc 256  Q
    ||||||||||||||||||||||||||||||||||||    
9411050 ttagtggaaattaagcattgaatatcattttctctc 9411015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 15 - 124
Target Start/End: Complemental strand, 9411288 - 9411179
Alignment:
15 acccaaaaccaaatcaaaattaaacacgagtcagctgtgtctattttattattaatccgataaacaattgtggtgtccatttataggccattagatattt 114  Q
    ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9411288 acccaaaaccaaatcaaaattaagcatgagtcagctgtgtctattttattattaatccgataaacaattgtggtgtccatttataggccattagatattt 9411189  T
115 taatagatta 124  Q
    ||||||||||    
9411188 taatagatta 9411179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 302
Target Start/End: Complemental strand, 9411003 - 9410974
Alignment:
273 gcattgaatatcattttattgggtcatgac 302  Q
    ||||||||||||||||||||||||||||||    
9411003 gcattgaatatcattttattgggtcatgac 9410974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University