View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4438-Insertion-2 (Length: 147)
Name: NF4438-Insertion-2
Description: NF4438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4438-Insertion-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 1e-70; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 37704459 - 37704321
Alignment:
| Q |
8 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37704459 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc |
37704360 |
T |
 |
| Q |
108 |
tattgccttattttacttttcacttgttgttgttattgc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37704359 |
tattgccttattttacttttcacttgttcttgttattgc |
37704321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 37437525 - 37437445
Alignment:
| Q |
8 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaa |
88 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37437525 |
tttggtccttgccccttagtttcaagttatgtttcctatataaatagaggctaatcatttggtatatcctaaatcatcaaa |
37437445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 37698641 - 37698571
Alignment:
| Q |
8 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta |
78 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37698641 |
tttggtcctttccccgtagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta |
37698571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 95 - 141
Target Start/End: Complemental strand, 37641585 - 37641539
Alignment:
| Q |
95 |
tccttttttattctattgccttattttacttttcacttgttgttgtt |
141 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
37641585 |
tccttttttattccattgccttattttacctttcacttcttgttgtt |
37641539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 87 - 141
Target Start/End: Complemental strand, 37698505 - 37698451
Alignment:
| Q |
87 |
aaatgcggtccttttttattctattgccttattttacttttcacttgttgttgtt |
141 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| | |||||||| || ||||| |
|
|
| T |
37698505 |
aaatggggtccttttttattctattgccttattttgcctttcactttttcttgtt |
37698451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 87 - 135
Target Start/End: Original strand, 37391389 - 37391437
Alignment:
| Q |
87 |
aaatgcggtccttttttattctattgccttattttacttttcacttgtt |
135 |
Q |
| |
|
||||| ||||||| |||||| |||||||||||||||| ||||||||||| |
|
|
| T |
37391389 |
aaatggggtccttgtttattttattgccttattttacctttcacttgtt |
37391437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 93 - 135
Target Start/End: Complemental strand, 37441650 - 37441608
Alignment:
| Q |
93 |
ggtccttttttattctattgccttattttacttttcacttgtt |
135 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
37441650 |
ggtccttttttattttattgccttattttacctttcacatgtt |
37441608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 95 - 141
Target Start/End: Complemental strand, 37534804 - 37534758
Alignment:
| Q |
95 |
tccttttttattctattgccttattttacttttcacttgttgttgtt |
141 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| || ||||| |
|
|
| T |
37534804 |
tccttttttattccattgccttattttacctttcactttttcttgtt |
37534758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 95 - 141
Target Start/End: Complemental strand, 37596037 - 37595991
Alignment:
| Q |
95 |
tccttttttattctattgccttattttacttttcacttgttgttgtt |
141 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| || ||||| |
|
|
| T |
37596037 |
tccttttttattccattgccttattttacctttcactttttcttgtt |
37595991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 95 - 132
Target Start/End: Complemental strand, 37713328 - 37713291
Alignment:
| Q |
95 |
tccttttttattctattgccttattttacttttcactt |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
37713328 |
tccttttttattccattgccttattttacctttcactt |
37713291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 9e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 16841203 - 16841272
Alignment:
| Q |
22 |
cttagtttcaggttatgtttcctatataaata---gaggctaatcaattggtatatcctaaatcatcaaa |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
16841203 |
cttagtttcaggttatgtttcctatataaatagaggaggctaatcagttggtatatcgtaaatcatcaaa |
16841272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 95 - 132
Target Start/End: Complemental strand, 14554760 - 14554723
Alignment:
| Q |
95 |
tccttttttattctattgccttattttacttttcactt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14554760 |
tccttttttattctattgccttattttacctttcactt |
14554723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University