View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4438_high_13 (Length: 208)
Name: NF4438_high_13
Description: NF4438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4438_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 6742477 - 6742302
Alignment:
| Q |
13 |
cacagatcaacgcaatatagaagctttaacctcatagaaaaacgcaaagannnnnnnnnnnnnnnnnggagggaaacacaaagattcttgaaaatgattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6742477 |
cacagatcaacgcaatatagaagctttaacctcataaaaaaacgcaaagattttttattgtttt---ggagggaaacacaaagattcttgaaaatgattg |
6742381 |
T |
|
| Q |
113 |
aaatcgatatattcggttagaggtgagtgatgtgcccttcttcgacacccacaacagtaacacaaatgttgttggtctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6742380 |
aaatcgatatattcggttagaggtgagtgatgttcccttcttcgacacccacaacagtaacacaaatgttgttggtctt |
6742302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University