View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4438_low_14 (Length: 245)
Name: NF4438_low_14
Description: NF4438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4438_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 230
Target Start/End: Original strand, 33583152 - 33583378
Alignment:
| Q |
4 |
cccatatttatttcgatcaccaatttttatattcctcagatttcaatctcgatctaaaatatgtaattcattatcttcatttgtccagttttccactaag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33583152 |
cccatatttatttcgatcaccaatttttatattcctcaaatttcaaactcgatctaaaatatgtaaatcattatcttgctttgtccagttttccactaag |
33583251 |
T |
 |
| Q |
104 |
agttctgttatccaggatttgtaatctgggaggacgattggtttgggttaatttagaatggcttatacaggtgatattaattgtggacacgagtacgaca |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
33583252 |
agttctgttatccaggatttgtaatccaggaggacgattggtttgggtgaatttagaatggcttatacagatgatattaattgtggactcgagtacgaca |
33583351 |
T |
 |
| Q |
204 |
ttatcagctgatattaattgttttaat |
230 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
33583352 |
ttatcagatgatattaattgttttaat |
33583378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University