View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4438_low_15 (Length: 238)
Name: NF4438_low_15
Description: NF4438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4438_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 36605795 - 36606023
Alignment:
| Q |
8 |
gacatcatcaaaagctgggggaagatggccagaagcaggcctttctgttgctagattctgtaaaaccattcccttctcttcttctaaaactttctggctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605795 |
gacatcatcaaaagctgggggaagatggccagaagcaggcctttctgttgctagattctgtaaaaccattcccttctcttcttctaaaactttctggctt |
36605894 |
T |
 |
| Q |
108 |
gaaattttagtagatatattcagaggtgcaatttcagccactgaggacactctttccctcaccatgaacttgtcatcaccagttgagatgtacataagct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605895 |
gaaattttagtagatatattcagaggtgcaatttcagccactgaggacactctttccctcaccatgaacttgtcatcaccagttgagatgtacataagct |
36605994 |
T |
 |
| Q |
208 |
ttggctggctaactttatgaggcctatta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36605995 |
ttggctggctaactttatgaggcctatta |
36606023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University