View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4439-Insertion-6 (Length: 321)
Name: NF4439-Insertion-6
Description: NF4439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4439-Insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 13 - 139
Target Start/End: Original strand, 9335052 - 9335178
Alignment:
| Q |
13 |
catggggtagaaattcacttaagtaagacatctaagattcaaataacaaccgttaatatagacctaatttacaccaacccattaaactcaaaactcaaaa |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9335052 |
catgggttagaaattcacttaagtaagacatctaagattcaaataacaaccgttaatatagacctaatttacaccaacccattaaactcaaaactcaaaa |
9335151 |
T |
|
| Q |
113 |
atgaaaattacattttcttgactatac |
139 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9335152 |
atgaaaattacattttcttgactatac |
9335178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 217 - 321
Target Start/End: Original strand, 9335263 - 9335367
Alignment:
| Q |
217 |
gaacaatatatcacagtgtctcgtggttgttcctgaatgttttacaaacacaccccctcagcccccaaacccttctattctctctcttcgtttctgagtc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9335263 |
gaacaatatatcacagtgtctcgtggttgttcctgaatgttttacaaacacaccctctcagcccccaaacccttctattctctctcttcgtttctgagtc |
9335362 |
T |
|
| Q |
317 |
tcctc |
321 |
Q |
| |
|
||||| |
|
|
| T |
9335363 |
tcctc |
9335367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University