View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4439-Insertion-9 (Length: 176)
Name: NF4439-Insertion-9
Description: NF4439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4439-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 10 - 175
Target Start/End: Original strand, 47310046 - 47310211
Alignment:
| Q |
10 |
aatcatgttctaaagatttcagtagattacaatcaagcaagaatgacgaacaaaattatttccaacgtgtgataggtttccttaggtgggggcctccgca |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47310046 |
aatcatgttctaaagatttcattagattacaatcaagcaagaatgacgaacaaaattatttccaacgtgtgataggtttccttaggtggaggcctccgca |
47310145 |
T |
|
| Q |
110 |
agataattgggtgaatttaaatacggatggtgcttgtaggggagggaatatagtttagttgttgtg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47310146 |
agataattgggtgaatttaaatacggatggtgcttgtaggggagggaatatagtttagttgttgtg |
47310211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University