View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4439_low_3 (Length: 408)
Name: NF4439_low_3
Description: NF4439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4439_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 88 - 280
Target Start/End: Complemental strand, 33450191 - 33449991
Alignment:
| Q |
88 |
aatattgtggagaagaaaaagggtgttatgatatatttattcttgagacttctttttacgtatttgtccctcagttttcagtatataactattgtgacat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33450191 |
aatattgtggagaagaaaaagggtgttatgatatatattttcttgagacttctttttacgtatttgtccctcagttttcagtatataacttttgtgacat |
33450092 |
T |
|
| Q |
188 |
tgctgcttatgtacgg--------tttcnnnnnnncctttcctcttgacagaagtctagtttctttccatttaattgaggttgcattttatcatttcaca |
279 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33450091 |
tgctgcttatgtacggtttcttaatttctttttttcctttcctcttgagagaagtctagtttctttccatttaattaagattgcattttatcatttcaca |
33449992 |
T |
|
| Q |
280 |
c |
280 |
Q |
| |
|
| |
|
|
| T |
33449991 |
c |
33449991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University