View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4439_low_4 (Length: 264)
Name: NF4439_low_4
Description: NF4439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4439_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 68 - 255
Target Start/End: Original strand, 5973115 - 5973302
Alignment:
| Q |
68 |
atgtaactgtttccataatatcaatttaattccaattccaacgttacccttttggataaatgtactctaagcactgaaaagtttcaatctttacttgttt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5973115 |
atgtaactgtttccataatatcaatttaattccaattccaacgttacccttttggataaatgtactctaagcactgaaaagtttcaatctttacttgttt |
5973214 |
T |
|
| Q |
168 |
tgattgaatagagaaaaacccagatggatttttcttcgttttgtacctctcttggtacttcatttgtgatatttttagttttgatgat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5973215 |
tgattgaatagagaaaaacccagatggatttttcttcgttttgtacctctcttggtacttcatttgtgatatttttagttttgatgat |
5973302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University