View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4439_low_6 (Length: 236)
Name: NF4439_low_6
Description: NF4439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4439_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5973279 - 5973502
Alignment:
| Q |
1 |
tgtgatatttttagttttgatgattttgtttgctttgttacaaagtaaacctgggaacaatgtggtgtactatcctaataggatcttgaagggtttagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5973279 |
tgtgatatttttagttttgatgattttgtttgctttgttacaaagtaaacctgggaacaatgtggtgtactatcctaataggatcttgaagggtttagat |
5973378 |
T |
 |
| Q |
101 |
ccatttgaaggtggttctaagacacgtaatcctttctcttggattaaggaagctttttcttcttctgaacaagatgttattgctatgtctggtgttgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5973379 |
ccatttgaaggtggttctaagacacgtaatcctttctcttggattaaggaagctttttcttcttctgaacaagatgttattgctatgtctggtcttgata |
5973478 |
T |
 |
| Q |
201 |
ctgctgttttctttgtctttctca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5973479 |
ctgctgttttctttgtctttctca |
5973502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 182
Target Start/End: Complemental strand, 1933391 - 1933342
Alignment:
| Q |
133 |
tttctcttggattaaggaagctttttcttcttctgaacaagatgttattg |
182 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||| |||||||| |||||| |
|
|
| T |
1933391 |
tttctctttgattatggaagccttttcttcttctaaacaagattttattg |
1933342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University