View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4440_high_6 (Length: 213)
Name: NF4440_high_6
Description: NF4440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4440_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 17 - 162
Target Start/End: Original strand, 24566417 - 24566562
Alignment:
| Q |
17 |
aaatggtttacatctagcttctcaacgaactcctatgtttaatttgtgataaaattgtttagatcctagcttttcaagcaattcatgtgttttttccttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24566417 |
aaatggtttacatctagcttctcaacgaactcctatgtttaatatgtgataaaattgtttagatcctagcttttcaagcaattcatgtgttttttcctat |
24566516 |
T |
|
| Q |
117 |
gactttgtgttggtttcgaacggaatccgagtttggatttaatttt |
162 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
24566517 |
gactttgtgttggttttgaatggaatccgagtttggatttaatttt |
24566562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 20889864 - 20889801
Alignment:
| Q |
17 |
aaatggtttacatctagcttctcaacgaactcctatgtttaatttgtgataaaattgtttagat |
80 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
20889864 |
aaatggtttagatctagcttctctacgaattcctatgtttaatttgcgataaaattgtttagat |
20889801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University