View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4441_high_5 (Length: 236)
Name: NF4441_high_5
Description: NF4441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4441_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 26537181 - 26537384
Alignment:
| Q |
19 |
aaatctacctcgctcatcttactcggtacaaaattgaggaatgcctggtgaattgctggtttgagagcaaaaatctgatattttatttctcgagtcaatt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26537181 |
aaatctacctcgctcatgttactcggtacaaaattgaggaatgcctggtgaattgctggtttgagagcaaaaatctgatattttatttctcgagtcaatt |
26537280 |
T |
 |
| Q |
119 |
gaaatttaactatatttatccgaccgtcactagtagtaggctttgtgtcgaagatcaaacaatttttaaatccaatcctttgttttaactttcggctttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26537281 |
gaaatttaactatatttatccgaccgtcactagtagtaggctttgtgtcgaagatcaaacaatttttaaatccaatcctttgtgttaactttcggctttc |
26537380 |
T |
 |
| Q |
219 |
atct |
222 |
Q |
| |
|
|||| |
|
|
| T |
26537381 |
atct |
26537384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 152 - 222
Target Start/End: Original strand, 40355494 - 40355564
Alignment:
| Q |
152 |
tagtaggctttgtgtcgaagatcaaacaatttttaaatccaatcctttgttttaactttcggctttcatct |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40355494 |
tagtaggctttgtgtcgaagatcaaagaatttttaaatccaatcctttgttttaactttcggctttcatct |
40355564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 36 - 95
Target Start/End: Original strand, 40351165 - 40351224
Alignment:
| Q |
36 |
cttactcggtacaaaattgaggaatgcctggtgaattgctggtttgagagcaaaaatctg |
95 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
40351165 |
cttactgggtacaaaattgaggaatgcctggtgaactgctggtttgagggcaaaaatctg |
40351224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University