View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4442_high_6 (Length: 277)
Name: NF4442_high_6
Description: NF4442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4442_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 6915847 - 6916100
Alignment:
| Q |
10 |
ccagagagtgggcaaacaatcatttctggaatgggagaactacacttagatatttatgttaaatgcattaagatggagtatggggttgatgctacagttg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915847 |
ccagagagtgggcaaacaatcatttctggaatgggagaactacacttagatatttatgttaaacgcattaagatggagtatggggttgatgctacagttg |
6915946 |
T |
 |
| Q |
110 |
gaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggaggacaaggacaatatggacgagt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6915947 |
gaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggagggcaaggacaatatggacgagt |
6916046 |
T |
 |
| Q |
210 |
gattggatatattgaaccacttcctgctgggtcaggaactaagtttgaatttga |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916047 |
gattggatatattgaaccacttcctgctgggtcaggaactaagtttgaatttga |
6916100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 93 - 215
Target Start/End: Complemental strand, 15039391 - 15039269
Alignment:
| Q |
93 |
ggttgatgctacagttggaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggaggacaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
15039391 |
ggttgatgctacagttggaaagccccgtgtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatccggagggcaa |
15039292 |
T |
 |
| Q |
193 |
ggacaatatggacgagtgattgg |
215 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
15039291 |
ggacaatatggacgggtgattgg |
15039269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 217 - 263
Target Start/End: Complemental strand, 15038438 - 15038392
Alignment:
| Q |
217 |
tatattgaaccacttcctgctgggtcaggaactaagtttgaatttga |
263 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15038438 |
tatattgaaccactccctgctgggtcagaaactaagtttgaatttga |
15038392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 15039977 - 15039923
Alignment:
| Q |
25 |
acaatcatttctggaatgggagaactacacttagatatttatgttaaatgcatta |
79 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||||| || |||||| |
|
|
| T |
15039977 |
acaattatttctggaatgggagaactgcacttagatatctatgttgaacgcatta |
15039923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University