View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4443-Insertion-9 (Length: 307)
Name: NF4443-Insertion-9
Description: NF4443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4443-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 70 - 307
Target Start/End: Original strand, 38948039 - 38948279
Alignment:
| Q |
70 |
aatttcacattgtaaatgatttacattgttaattttagattggatgactcatattacactagaataaaataagatgtac---taaatgatctaggacgtt |
166 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| | |||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38948039 |
aatttcacgttgtaaatgatctacattgttaattttagatcgaatgactcatattacaccagaataaaataagatgtaggagtaaatgatctaggacgtt |
38948138 |
T |
|
| Q |
167 |
tattgagatcggatagctgagatgcaaatctacttgacacattaaatgcaccaaatctatctactaatacacaatttctcaagagatttttattgtgatt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
38948139 |
cattgagatcggatagctgagatgcaaatctacttgacacattaaatgcaccaaatctatctactaattcccaatttctcaagagatttttattgtgatt |
38948238 |
T |
|
| Q |
267 |
atgtgtatgnnnnnnnntacattacagtaataattgaggtc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
38948239 |
atgtgtatgaaaaaaaatacattacagtaataattgaggtc |
38948279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University