View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445-Insertion-10 (Length: 553)
Name: NF4445-Insertion-10
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445-Insertion-10 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 172 - 553
Target Start/End: Complemental strand, 12333412 - 12333015
Alignment:
| Q |
172 |
gtttcattttgggtactgattctccaccatttttggctttttgtttaatctctcccttattcctagcagacaaaaattgcggtgatttccttagtttt-- |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
12333412 |
gtttcattttgggtactgattctccaccatttttggctttttgtttaatctctcccttattcctagcagacaaaa-ttgcgctgatttccttagttttaa |
12333314 |
T |
|
| Q |
270 |
-----------gaaaacaaaggtttaagttggtttttaactgaatttgaaacttgtttttctctcaaaccctaaaccactaaagtaggttgttttgttag |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12333313 |
aaatcagttttgaaaacaaaggtttaagttggtttttaactcaatttgaaacttgtttttctctcaaaccctaaaccactaaagtaggttgttttgttag |
12333214 |
T |
|
| Q |
359 |
ttgtttccatttacacgctccacatcttttgtcttccccttcaacttcatagcgatttccattcatcaccatccctgaa--gtcgccatcatcaccaccg |
456 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
12333213 |
tggtttccatttacacgctccacatctttcgtcttccccttcaacttcatcatgatttccattcatcaccatccctgaagtgtcgccatcgtcaccaccg |
12333114 |
T |
|
| Q |
457 |
t--ccgccgtccttccttccttattccccgttctagggttcctttcttcttctcaggtttgtttcttattcctcttttattttttataaataacatctg |
553 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12333113 |
tagccgccgtccttccttccttattccccgttctagggttcctttcttcttctcaggtttgtttcttgttcctcttttattttttataaataacatctg |
12333015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 14 - 91
Target Start/End: Complemental strand, 12333749 - 12333672
Alignment:
| Q |
14 |
ccccatgaaaaatttgaattccaccgctttctcggcttcacactatttggtcactagctctaatttattaaataaaat |
91 |
Q |
| |
|
||||| ||||| ||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12333749 |
ccccaagaaaagtttgaataccacccctttctcggctttacactatttggtcactagctctaatttattaaataaaat |
12333672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University