View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445-Insertion-15 (Length: 278)
Name: NF4445-Insertion-15
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445-Insertion-15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 35 - 278
Target Start/End: Complemental strand, 52037993 - 52037749
Alignment:
| Q |
35 |
tcaacttcaaaggtttttgtctacaggtaaaaacaacaagttt-ggaatcaaaaattacaattttgacccgataatgtttttggaggaacataaaattta |
133 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52037993 |
tcaaattcaaaggtttttgtctacaggtaaaaacaacaagttttggaatcaaaaattacaattttgacccgataatgtttttggaggaacataaaattta |
52037894 |
T |
|
| Q |
134 |
aatatttttgccagtgctttttaaactcaaagatcttctatatcatcaatcggagcattattctctcccaatatatttctctcataacnnnnnnngggat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52037893 |
aatatttttgccagtgctttttaaactcaaagatcttctatatcatcaatcggagcattattctctcccaatatatttctctcataacaaaaaaagggat |
52037794 |
T |
|
| Q |
234 |
attctcttgaaaaagtaaacctccaaatatttgccctacgcgcca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52037793 |
attctcttgaaaaagtaaacctccaaatatttgccctacccgcca |
52037749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University