View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445-Insertion-16 (Length: 266)
Name: NF4445-Insertion-16
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445-Insertion-16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 53414579 - 53414473
Alignment:
| Q |
8 |
ttcttgttcgatttagcagtggaagtggacgacggactggaatagaaaatgctgtagaacatggtgggacgcggcgacactgtgaaaagacgagttaggg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53414579 |
ttcttgttcgatttagcagtggaagtggacgacggactggaatagaaaatgctgtagaacatggtgggacgcggcgacactgtgaaaagatgagttaggg |
53414480 |
T |
|
| Q |
108 |
ttttcaa |
114 |
Q |
| |
|
||||||| |
|
|
| T |
53414479 |
ttttcaa |
53414473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 130 - 171
Target Start/End: Complemental strand, 53414319 - 53414278
Alignment:
| Q |
130 |
ttccaaaataaattgtcctaataacaattttttatttctgga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53414319 |
ttccaaaataaattgtcctaataacaattttttatttctgga |
53414278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 237 - 266
Target Start/End: Complemental strand, 53414214 - 53414185
Alignment:
| Q |
237 |
gaaaacttataattctttctttggctgtaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53414214 |
gaaaacttataattctttctttggctgtaa |
53414185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University