View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445-Insertion-32 (Length: 113)
Name: NF4445-Insertion-32
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445-Insertion-32 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 41131349 - 41131455
Alignment:
| Q |
8 |
aaaggaatgggaagaagg-aggaaaaatagtattgagagaaatagtcgacttttagatttttggtgttctaaagaaaactaaaaacattgtgtcttctta |
106 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41131349 |
aaaggaatggaaagaaggcaggaaaaatagtattgagagaaatagtcgacttttagatttttggtgttctaaagaaaactaaaaacattgtgtcttcgta |
41131448 |
T |
 |
| Q |
107 |
attatta |
113 |
Q |
| |
|
||||||| |
|
|
| T |
41131449 |
attatta |
41131455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University