View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445-Insertion-32 (Length: 113)

Name: NF4445-Insertion-32
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445-Insertion-32
NF4445-Insertion-32
[»] chr7 (1 HSPs)
chr7 (8-113)||(41131349-41131455)


Alignment Details
Target: chr7 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 41131349 - 41131455
Alignment:
8 aaaggaatgggaagaagg-aggaaaaatagtattgagagaaatagtcgacttttagatttttggtgttctaaagaaaactaaaaacattgtgtcttctta 106  Q
    |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
41131349 aaaggaatggaaagaaggcaggaaaaatagtattgagagaaatagtcgacttttagatttttggtgttctaaagaaaactaaaaacattgtgtcttcgta 41131448  T
107 attatta 113  Q
    |||||||    
41131449 attatta 41131455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University