View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_101 (Length: 248)
Name: NF4445_high_101
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_101 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 45197761 - 45197994
Alignment:
| Q |
19 |
aatgtgcaaatgattcacttaatcctggacggagggaatatgttttatgtnnnnnnnttactttttaaagtttcaatgcattgaaatacgtatcattttt |
118 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45197761 |
aatgtgcaaatgattcacttaatcttagacggagggagtaagttttatgtaaaaaagttactttttaaagtttcaatgcattgaaatacgtatcattttt |
45197860 |
T |
 |
| Q |
119 |
aagacaac--ttattttttagactttttaacaagtgtcttgaatgcatttgctaacatttcccttccttttattattttctc-aaagataa-ttttttat |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| || |||||||| |||||||| |
|
|
| T |
45197861 |
aagacaaagtttattttttagactttttaacaagtgtcttgaatgcatttgctagcatttcccttctttttattattttgtcaaaagataatttttttat |
45197960 |
T |
 |
| Q |
215 |
acaaatatttggggaaatcttaaaattttatcct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45197961 |
acaaatatttggggaaatcttaaaattttatcct |
45197994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 178
Target Start/End: Complemental strand, 5909087 - 5909042
Alignment:
| Q |
133 |
tttagactttttaacaagtgtcttgaatgcatttgctaacatttcc |
178 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
5909087 |
tttagacttcttaacaagtgtcttgaaggcatttgttagcatttcc |
5909042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University