View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_114 (Length: 240)
Name: NF4445_high_114
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_114 |
 |  |
|
| [»] scaffold0013 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 69 - 240
Target Start/End: Complemental strand, 39205 - 39034
Alignment:
| Q |
69 |
atgcacatattacgcaactcaccgaggattcaaagtattttaatgcacatattacacaattcgccgaggatttgatgtttatatgcaattttaacatgat |
168 |
Q |
| |
|
||||||||||||| ||| || ||||| ||| |||||||||| |||||||| |||| || || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39205 |
atgcacatattacacaattcgccgagtatttgaagtattttattgcacatactacaaaactcaccgaggatttgatgtttatatgcaattttaacatgat |
39106 |
T |
 |
| Q |
169 |
ttgatatgtttataagtggtcagtcttgaaaatgatttttagtctatgctattgagaaagactaatagtgtt |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39105 |
ttgatatgtttataagtggccagtcttgaaaatgatttttagtctatgctattgagaaagactgatagtgtt |
39034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 26 - 143
Target Start/End: Complemental strand, 39290 - 39173
Alignment:
| Q |
26 |
catcaggcacaatataattattattcttcttctcttgactcatatgcacatattacgcaactcaccgaggattcaaagtattttaatgcacatattacac |
125 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39290 |
catcaggcacagtataattattcttcttcttctcttgactcatatgcacatattacgcaactcaccgaggattcaaagtattttaatgcacatattacac |
39191 |
T |
 |
| Q |
126 |
aattcgccgaggatttga |
143 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
39190 |
aattcgccgagtatttga |
39173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University