View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_116 (Length: 239)
Name: NF4445_high_116
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_116 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 21 - 145
Target Start/End: Complemental strand, 8481084 - 8480960
Alignment:
| Q |
21 |
gatgcatactaagattgtctacttatatgtatgttgcgtgttgtgtccgtgcctgtgtcaatgctctataggtcataatcaatttctttgctgaattact |
120 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8481084 |
gatgcatactaagattgtctacgtatatgtatgttgcgtgttgtgtccgtgcctgtgtcaatgctctataggtcataatcaatttctttgctgaattact |
8480985 |
T |
 |
| Q |
121 |
agatgcatactaatattgtccattg |
145 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8480984 |
agatgcatactaatattgtccattg |
8480960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University