View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445_high_116 (Length: 239)

Name: NF4445_high_116
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445_high_116
NF4445_high_116
[»] chr2 (1 HSPs)
chr2 (21-145)||(8480960-8481084)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 21 - 145
Target Start/End: Complemental strand, 8481084 - 8480960
Alignment:
21 gatgcatactaagattgtctacttatatgtatgttgcgtgttgtgtccgtgcctgtgtcaatgctctataggtcataatcaatttctttgctgaattact 120  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8481084 gatgcatactaagattgtctacgtatatgtatgttgcgtgttgtgtccgtgcctgtgtcaatgctctataggtcataatcaatttctttgctgaattact 8480985  T
121 agatgcatactaatattgtccattg 145  Q
    |||||||||||||||||||||||||    
8480984 agatgcatactaatattgtccattg 8480960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University