View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_124 (Length: 235)
Name: NF4445_high_124
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 41737297 - 41737082
Alignment:
| Q |
5 |
tggatagattgaatggatgaaattgttaccttcatatttatcagtaaaatgattatgcgtgtgagggtatgagagctaggatacaataaagtaaggttgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41737297 |
tggatagattgaatggatgaaattgttaccttcatatttatcagtaaaatgattatgcgtgcgagggtatgagagctaggatacaataaagtaaggttgt |
41737198 |
T |
 |
| Q |
105 |
acaccaaatgtagtaatttaccacaaatggtcttgtgaaagatttgcatatggactgattaggaaaggatcaaagaaggtaagggaaagcgaaattgtcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41737197 |
acaccaaatgtagtaatttaccacaaatggtcttgtgagagatttgcatatggactgattaggaaaggatcaaagaaggtaagggaaagcgaaattgtcc |
41737098 |
T |
 |
| Q |
205 |
atttgaacgtcaaaat |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41737097 |
atttgaacgtcaaaat |
41737082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University