View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_128 (Length: 232)
Name: NF4445_high_128
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_128 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 48450193 - 48449979
Alignment:
| Q |
1 |
caggaaagctagcagatagtaaagttgtgtatcagacaatgacacttgtacaagaaattttgagaacgaatcgcgatcatgtgtcacttcttgcccacct |
100 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48450193 |
caggaaagctagctgagagtaaagtttggtatcagacaatgacacttgtacaagaaattttgagaacgaatcgcgatcatgtgtcacttcttgcccacct |
48450094 |
T |
 |
| Q |
101 |
tcttcttcatcgtcataatccgccatacaaacactgtcatcgtcacaatcacattcaccagatgtataatcgtcgcacatcacgtccatatcaacgcttt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48450093 |
tcttcttcatcgtcataatccgctatacaaacactgtcatcgtcacaatcacattcaccagatgtataatcgtcgcacatcacgtccatatcaacgcttt |
48449994 |
T |
 |
| Q |
201 |
ctttcggtaacctgt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48449993 |
ctttcggtaacctgt |
48449979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University