View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4445_high_134 (Length: 222)

Name: NF4445_high_134
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4445_high_134
NF4445_high_134
[»] chr3 (1 HSPs)
chr3 (89-207)||(3595054-3595172)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 89 - 207
Target Start/End: Complemental strand, 3595172 - 3595054
Alignment:
89 gtgaaatcactttcactttacatgattttgaagaatcttctatattatattctctctcctttataaggaatcttctatctattattcgcatttgcttgtc 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
3595172 gtgaaatcactttcactttacatgattttgaagaatcttctatattatattctctctcctttataaggaatcttctatctattattcgcatttgtttgtc 3595073  T
189 tattagctgttactaaatg 207  Q
    ||||||| | |||||||||    
3595072 tattagccgatactaaatg 3595054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University