View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_135 (Length: 221)
Name: NF4445_high_135
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_135 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 71 - 204
Target Start/End: Original strand, 47219570 - 47219703
Alignment:
| Q |
71 |
atcttattatgtttttagttctcctttatttcagaaatgatgtgtgatagaccctctgttattagttagggaagggatgtaaacatagataaccaaatac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47219570 |
atcttattatgtttttagttctcctttatttaagaaatgatgggtgatagaccctctgttattagttagggaagggatgtaaacatagataaccaaatac |
47219669 |
T |
|
| Q |
171 |
actctataggggaaggaaggattaggtatcagtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47219670 |
actctataggggaaggaaggattaggtatcagtt |
47219703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University