View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_28 (Length: 406)
Name: NF4445_high_28
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_28 |
 |  |
|
| [»] chr5 (175 HSPs) |
 |  |
|
| [»] chr1 (214 HSPs) |
 |  |
|
| [»] chr8 (191 HSPs) |
 |  |
|
| [»] chr3 (221 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0137 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 9e-86; HSPs: 221)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 870676 - 870914
Alignment:
| Q |
7 |
ataggaaatcatgtgtaataccgaaatccccaattctaaaagttatgttacaaaagatattgaccatctctttcattttacacttggtccaattaaaata |
106 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
870676 |
ataggaaatcatgtgtactacccaagtccccaattctaaaagttatgttacaaaagatattgaccatctctttcatttttcacttggtccaattaaa-ta |
870774 |
T |
 |
| Q |
107 |
ttcataaatattggcaaagagtgaaggttaagcccaaaaatgttagaagattcatgaacgttaaaaagaagaagaaattagaatagttcaattggtttgt |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||| |||||| || |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
870775 |
ttcataaatattggcaaagagtaaaggttgagcccaaaaatgttagaaaattcataaatgttaaaaagaagaagaaattaggatagttcaattggtttgt |
870874 |
T |
 |
| Q |
207 |
agttctattaaattaaaggttaagggagctggaagttttagattt |
251 |
Q |
| |
|
|||| | ||||||| |||| |||||||||||||||| |||| |
|
|
| T |
870875 |
agttgt-----attaaagattaatggagctggaagttttaaattt |
870914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 31560695 - 31560583
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt |
31560596 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31560595 |
ttggaaatagtcc |
31560583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 44925484 - 44925596
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt-gtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||| || |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctcagtaaaaaaaattgttgtttttggtccccgcaaaatattttgttt |
44925583 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
44925584 |
ttgaaaatagtcc |
44925596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 13631225 - 13631340
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
13631225 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
13631324 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13631325 |
tttttggaaatagtcc |
13631340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 35464015 - 35464130
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
35464015 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
35464114 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35464115 |
tttttggaaatagtcc |
35464130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 23779226 - 23779113
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaaatattttgtt |
23779127 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
23779126 |
tttgaaaatagtcc |
23779113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 41346220 - 41346167
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
41346167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 53916049 - 53915935
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
53916049 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttgt |
53915950 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53915949 |
ttttggaaatagtcc |
53915935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 285 - 347
Target Start/End: Complemental strand, 13479622 - 13479560
Alignment:
| Q |
285 |
attaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| || |||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13479622 |
attaaatactaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13479560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 14488190 - 14488136
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14488190 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
14488136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 23245597 - 23245483
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgt |
23245498 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
23245497 |
ttttggaaatggtcc |
23245483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 46088063 - 46088009
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46088063 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
46088009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 123532 - 123585
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
123532 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
123585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 9289264 - 9289317
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9289264 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
9289317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 13530714 - 13530601
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
13530615 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13530614 |
tttggaaatagtcc |
13530601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 22099913 - 22099860
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtct |
22099860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 293 - 346
Target Start/End: Original strand, 42823773 - 42823826
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
42823773 |
ttaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42823826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 42848026 - 42848139
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgtt |
42848125 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
42848126 |
tttggaaatggtcc |
42848139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 43231390 - 43231277
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
43231291 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43231290 |
tttggaaatagtcc |
43231277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 46292652 - 46292599
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtct |
46292599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 51709028 - 51708975
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtct |
51708975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 2180219 - 2180271
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
2180271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 6827875 - 6827823
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
6827823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 24474964 - 24474912
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
24474912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 29380911 - 29380859
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
29380859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 34361802 - 34361854
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
34361854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 291 - 347
Target Start/End: Original strand, 35763642 - 35763698
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35763642 |
tattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35763698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 292 - 348
Target Start/End: Original strand, 51708689 - 51708745
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
51708689 |
attaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtct |
51708745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 4279335 - 4279284
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtc |
4279284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 5827655 - 5827706
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
5827706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 35763957 - 35763843
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| || || || |||||||||||||| ||||||| ||||| |
|
|
| T |
35763957 |
taggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttgt |
35763858 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
35763857 |
ttttgaaaatagtcc |
35763843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 287 - 346
Target Start/End: Complemental strand, 45593595 - 45593536
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||| ||||||||||||||| |||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
45593595 |
taatttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagt |
45593536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 50714240 - 50714291
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
50714291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 50714565 - 50714514
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
50714514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 11285504 - 11285554
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
11285554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 12791977 - 12791923
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
12791977 |
ttaggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtc |
12791923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 14594203 - 14594257
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
14594203 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtc |
14594257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 406
Target Start/End: Complemental strand, 19903653 - 19903543
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatttt |
395 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaatattttgttttt |
19903554 |
T |
 |
| Q |
396 |
ggaaatagtcc |
406 |
Q |
| |
|
| ||||||||| |
|
|
| T |
19903553 |
gaaaatagtcc |
19903543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 20291984 - 20292038
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
20291984 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtct |
20292038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 22584285 - 22584339
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
22584285 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtct |
22584339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 29499181 - 29499294
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
29499280 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29499281 |
tttggaaatagtcc |
29499294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 30046793 - 30046680
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
30046694 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30046693 |
tttggaaatagtcc |
30046680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 30061134 - 30061021
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
30061035 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30061034 |
tttggaaatagtcc |
30061021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 47136170 - 47136120
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
47136120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 52430103 - 52430049
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
52430103 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc |
52430049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 9289641 - 9289588
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
9289588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 9445951 - 9446000
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
9446000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 29420539 - 29420486
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29420486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 293 - 346
Target Start/End: Original strand, 32365091 - 32365144
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
32365091 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32365144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 35415633 - 35415521
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||| || || || |||||||||||||| ||||||| ||||| || |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttgttt |
35415534 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
35415533 |
ttgaaaatagtcc |
35415521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 290 - 347
Target Start/End: Original strand, 52017499 - 52017556
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
52017499 |
ttataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
52017556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 52441761 - 52441814
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
52441761 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
52441814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 53716919 - 53716972
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53716919 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
53716972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 13064466 - 13064414
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
13064414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 14791807 - 14791755
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
14791755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 16712692 - 16712640
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16712640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 18205155 - 18205207
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18205207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 18205521 - 18205473
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18205473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 401
Target Start/End: Original strand, 25423923 - 25424031
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
25424022 |
T |
 |
| Q |
393 |
tttggaaat |
401 |
Q |
| |
|
|||| |||| |
|
|
| T |
25424023 |
tttgaaaat |
25424031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 25424313 - 25424261
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25424261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 32208541 - 32208593
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
32208593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 32365484 - 32365432
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
32365432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 36701999 - 36702051
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
36702051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 41345852 - 41345904
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
41345904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 43231087 - 43231139
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
43231139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 46115780 - 46115728
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtc |
46115728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 46128914 - 46128862
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtc |
46128862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 52017871 - 52017819
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
52017819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 52442093 - 52442041
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
52442041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 287 - 347
Target Start/End: Complemental strand, 55482477 - 55482417
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
55482477 |
taataatttggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtc |
55482417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 343
Target Start/End: Complemental strand, 9446323 - 9446276
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 13073759 - 13073810
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
13073810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 293 - 406
Target Start/End: Complemental strand, 13074128 - 13074013
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||| ||||||||||||| ||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
13074128 |
ttaggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatattttg |
13074029 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
13074028 |
tttttgaaaatagtcc |
13074013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 344
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 22099543 - 22099594
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22099594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 25358540 - 25358489
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtc |
25358489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 405
Target Start/End: Original strand, 28448832 - 28448942
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| ||| |||||||||||||| | | |||| |||||||||||| ||||||||||||| || |
|
|
| T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc-tctaaaaaaaattgtagtttttggtccctgcaaaatattttgttt |
28448930 |
T |
 |
| Q |
394 |
ttggaaatagtc |
405 |
Q |
| |
|
||| |||||||| |
|
|
| T |
28448931 |
ttgaaaatagtc |
28448942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 45505895 - 45505844
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45505844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 390
Target Start/End: Complemental strand, 53308068 - 53307973
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| | ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg |
53307973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 53717174 - 53717123
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
53717123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 123893 - 123847
Alignment:
| Q |
301 |
aaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
123847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 4279019 - 4279073
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
4279019 |
ttaggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtc |
4279073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 13064156 - 13064210
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
13064156 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
13064210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 14487800 - 14487914
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||| ||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgt |
14487899 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
14487900 |
ttttgaaaatagtcc |
14487914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 11693123 - 11693070
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
11693123 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtc |
11693070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 12152495 - 12152446
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 348
Target Start/End: Original strand, 14791502 - 14791551
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtct |
14791551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 26412188 - 26412241
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
26412188 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
26412241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 41619897 - 41619950
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
41619950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 43368467 - 43368516
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
43368516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 51545628 - 51545681
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtct |
51545681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 51545971 - 51545918
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
51545971 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
51545918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 54208822 - 54208773
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtct |
54208773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 2034856 - 2034804
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtc |
2034804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5052585 - 5052533
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
5052533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 5797484 - 5797532
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtc |
5797532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5827974 - 5827922
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc |
5827922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 8760603 - 8760655
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtc |
8760655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 8760782 - 8760730
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtc |
8760730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 13631600 - 13631548
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc |
13631548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 15555506 - 15555554
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
15555554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 24774044 - 24774096
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24774096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 28809181 - 28809129
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
28809129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 343
Target Start/End: Original strand, 29380667 - 29380715
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 29463914 - 29463866
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 31812214 - 31812162
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| |||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc |
31812162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 36054151 - 36054099
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| | |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtc |
36054099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 38054549 - 38054597
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
38054597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 41921085 - 41921033
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtc |
41921033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 45505599 - 45505651
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
45505651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 46115414 - 46115526
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| |||||||||||||||| ||||||||||||| || |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgttt |
46115513 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
46115514 |
ttgaaaatagtcc |
46115526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 46128548 - 46128660
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| |||||||||||||||| ||||||||||||| || |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgttt |
46128647 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
46128648 |
ttgaaaatagtcc |
46128660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 55072388 - 55072440
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
55072440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 2322433 - 2322382
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2322382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 13764613 - 13764664
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtc |
13764664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 19321859 - 19321808
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
19321808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 23245231 - 23245282
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
23245282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 26412584 - 26412533
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
26412533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 27008084 - 27008135
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
27008135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 28809011 - 28809062
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtc |
28809062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 35464382 - 35464331
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35464331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 346
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 42848391 - 42848340
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
42848340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 47023109 - 47023054
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
47023109 |
attaggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
47023054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 347
Target Start/End: Original strand, 2034544 - 2034590
Alignment:
| Q |
301 |
aaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
2034590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 309 - 347
Target Start/End: Complemental strand, 2034781 - 2034743
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtc |
2034743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 5882549 - 5882602
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
5882549 |
ttaggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtc |
5882602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 20144666 - 20144620
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
20144666 |
ttgttgtttttggtccctgcaaaatcttttgattttgaaaatagtcc |
20144620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 26412257 - 26412303
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
26412257 |
ttgttgtttttggtccctgccaaatattttgtttttggaaatagtcc |
26412303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 35420636 - 35420590
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
35420636 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
35420590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 36050289 - 36050339
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtc |
36050339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 47022806 - 47022852
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
47022806 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
47022852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 344
Target Start/End: Original strand, 51738135 - 51738185
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
51738135 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 51762936 - 51762982
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
51762936 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
51762982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 312 - 404
Target Start/End: Original strand, 54208477 - 54208571
Alignment:
| Q |
312 |
tagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgattttggaaatagt |
404 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtctctgcaaaatattttgattttgaaaatagt |
54208571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 344
Target Start/End: Complemental strand, 55072714 - 55072664
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
55072714 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 4211559 - 4211608
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 7642658 - 7642601
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||||||||| | ||| |||||||||||| || |||||||||||||| |
|
|
| T |
7642658 |
ttattcggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtc |
7642601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 8191397 - 8191340
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| ||| ||| ||||| |||| |
|
|
| T |
8191397 |
ttatttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtc |
8191340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 13530377 - 13530430
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
13530377 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc |
13530430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 18831176 - 18831127
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
18831127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 19321568 - 19321621
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| ||| ||| |||||||||||||| |
|
|
| T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtc |
19321621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 19903259 - 19903312
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
19903259 |
taggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtc |
19903312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 30564835 - 30564884
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtc |
30564884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 34355285 - 34355232
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
34355285 |
taggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtc |
34355232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 35119613 - 35119560
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
35119613 |
taggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtc |
35119560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 35415297 - 35415350
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
35415297 |
taggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc |
35415350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 41620262 - 41620205
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
41620262 |
ttataaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc |
41620205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 45474597 - 45474544
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtct |
45474544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 346
Target Start/End: Complemental strand, 51763201 - 51763152
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagt |
51763152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 53915681 - 53915734
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
53915681 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
53915734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 13764808 - 13764756
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||| || |||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtc |
13764756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 18136114 - 18136062
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
18136114 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtc |
18136062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 26314333 - 26314281
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtc |
26314281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 27427871 - 27427922
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtc |
27427922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 348
Target Start/End: Complemental strand, 27428206 - 27428150
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||| ||| ||||| ||||| | ||||||||||||||||||||| |||||||||| |
|
|
| T |
27428206 |
attaggttaagatatggttttaatacctgcaaatatgtctcattttcgttttagtct |
27428150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 29499543 - 29499495
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29499495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 31182505 - 31182453
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||| ||||||||| |||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtc |
31182453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 31811924 - 31811976
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtc |
31811976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 32208902 - 32208850
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| ||||| |||||||| |
|
|
| T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtc |
32208850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 47022743 - 47022791
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
47022791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 49123322 - 49123270
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
49123322 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtc |
49123270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 50822013 - 50822061
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtc |
50822061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 50822295 - 50822243
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||| ||| |||||||| |
|
|
| T |
50822295 |
aggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtc |
50822243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 54903476 - 54903424
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | | |||||||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtc |
54903424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 2180572 - 2180521
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtc |
2180521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 5203000 - 5203043
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
5203000 |
ttgtttttggtccgtgcaaaatattttgtttttggaaatagtcc |
5203043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 12791678 - 12791721
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
12791678 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
12791721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 13064225 - 13064268
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
13064225 |
ttgtttttggtccccgcaaaattttttgtttttgtaaatagtcc |
13064268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 42824091 - 42824040
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtc |
42824040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 292 - 347
Target Start/End: Original strand, 45593224 - 45593279
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||| ||| |||||| ||||||| |
|
|
| T |
45593224 |
attaggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtc |
45593279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 46292392 - 46292439
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 301 - 406
Target Start/End: Complemental strand, 47532667 - 47532560
Alignment:
| Q |
301 |
aaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgattttgga |
398 |
Q |
| |
|
||||||| |||| |||| |||||||||||||| ||||||||||||| | ||| ||||| ||||||||||| |||||||||||| ||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaattgttatttttggtccctgcaaaatattttatttttgga |
47532568 |
T |
 |
| Q |
399 |
aatagtcc |
406 |
Q |
| |
|
|||||||| |
|
|
| T |
47532567 |
aatagtcc |
47532560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 344
Target Start/End: Complemental strand, 5797822 - 5797772
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||| ||||||||| |||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
5797822 |
taggttaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 6353637 - 6353587
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc |
6353587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 7642580 - 7642546
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
7642580 |
ttttggtccctgcaaatatgtctcattttggtttt |
7642546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 8191076 - 8191126
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||| ||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtc |
8191126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 12791610 - 12791660
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
12791610 |
gctaaaatatagttttagtccctgcaaatatgtgccattttcgttttagtc |
12791660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 13631526 - 13631492
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
13631526 |
ttttggtccctgcaaatatgtctcattttggtttt |
13631492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 346
Target Start/End: Complemental strand, 14594561 - 14594515
Alignment:
| Q |
300 |
aaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagt |
14594515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 348
Target Start/End: Original strand, 16712331 - 16712381
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtct |
16712381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 19321643 - 19321677
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
19321643 |
ttttggtccctgcaaatatgtctcattttggtttt |
19321677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 22584610 - 22584556
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| || |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
22584610 |
ttaggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtc |
22584556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 23245304 - 23245338
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
23245304 |
ttttggtccctgcaaatatgtctcattttggtttt |
23245338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 26412511 - 26412477
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
26412511 |
ttttggtccctgcaaatatgtctcattttggtttt |
26412477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 27008401 - 27008355
Alignment:
| Q |
301 |
aaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtc |
27008355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 29499473 - 29499439
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29499473 |
ttttggtccctgcaaatatgtctcattttggtttt |
29499439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 30060842 - 30060876
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
30060842 |
ttttggtccctgcaaatatgtctcattttggtttt |
30060876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 31560404 - 31560438
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
31560404 |
ttttggtccctgcaaatatgtctcattttggtttt |
31560438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 35464309 - 35464275
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35464309 |
ttttggtccctgcaaatatgtctcattttggtttt |
35464275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 36702362 - 36702312
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||| ||| |||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtc |
36702312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 42848318 - 42848284
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
42848318 |
ttttggtccctgcaaatatgtctcattttggtttt |
42848284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 43231161 - 43231195
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
43231161 |
ttttggtccctgcaaatatgtctcattttggtttt |
43231195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 43231192 - 43231226
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
43231192 |
ttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 327
Target Start/End: Complemental strand, 45619793 - 45619759
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45619793 |
ttaggctaaaatatgtttttagtccctgcaaatat |
45619759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 50753988 - 50754034
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
50753988 |
ttgttgtttttggtccctgcaaaatattttgtatttgaaaatagtcc |
50754034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 53915756 - 53915790
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
53915756 |
ttttggtccctgcaaatatgtctcattttggtttt |
53915790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 54903177 - 54903223
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| ||||||||| |
|
|
| T |
54903177 |
ttgttgtttttgatccccgcaaaatattttgttttttaaaatagtcc |
54903223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 2322094 - 2322143
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| |||| |||||| |||||||| ||| ||||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
2322143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 363 - 404
Target Start/End: Complemental strand, 4279266 - 4279225
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagt |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
4279266 |
ttgtttttggtcccagcaaaatattttgtttttgaaaatagt |
4279225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 12152152 - 12152205
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
12152152 |
taggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtc |
12152205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 347
Target Start/End: Original strand, 29420231 - 29420260
Alignment:
| Q |
318 |
ctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29420231 |
ctgcaaatatgtctcattttggttttagtc |
29420260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 30060767 - 30060820
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
30060767 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtc |
30060820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 327
Target Start/End: Original strand, 35054660 - 35054693
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
35054660 |
taggttaaaatatgattttagtccctgcaaatat |
35054693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 35420701 - 35420652
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtc |
35420652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 51830891 - 51830940
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtc |
51830940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 8905234 - 8905186
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||||||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta |
8905186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 315 - 343
Target Start/End: Original strand, 19903340 - 19903368
Alignment:
| Q |
315 |
tccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19903340 |
tccctgcaaatatgtctcattttggtttt |
19903368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 24474599 - 24474650
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagt-cctgcaaatatgcatcgttttggttttagtc |
24474650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 309 - 341
Target Start/End: Complemental strand, 25358496 - 25358464
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtt |
341 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
25358496 |
ttttagtccctgcaaatatgtctcgttttggtt |
25358464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 344
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||| ||| ||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 31370802 - 31370854
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||| ||| ||||||||||||| |
|
|
| T |
31370802 |
taggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 31560330 - 31560382
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtc |
31560382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35119291 - 35119343
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtc |
35119343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 175)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 18258528 - 18258415
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc-ttgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgtt |
18258429 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18258428 |
tttggaaatagtcc |
18258415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 282 - 406
Target Start/End: Original strand, 5917113 - 5917238
Alignment:
| Q |
282 |
acaattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgc |
379 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| || |
|
|
| T |
5917113 |
acaattaattat-aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgc |
5917211 |
T |
 |
| Q |
380 |
aaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
5917212 |
aaaatattttgtttttggaaatagtcc |
5917238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 1381246 - 1381359
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt |
1381345 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1381346 |
tttggaaatagtcc |
1381359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 35928458 - 35928346
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt |
35928359 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35928358 |
ttggaaatagtcc |
35928346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 297 - 406
Target Start/End: Complemental strand, 2636992 - 2636882
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcttgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgatttt |
395 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || |||||||||||||| ||||||||||||| |||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgttttt |
2636893 |
T |
 |
| Q |
396 |
ggaaatagtcc |
406 |
Q |
| |
|
||||||||||| |
|
|
| T |
2636892 |
ggaaatagtcc |
2636882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 19565466 - 19565579
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgtt |
19565565 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19565566 |
tttggaaatagtcc |
19565579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 405
Target Start/End: Complemental strand, 35877055 - 35876941
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag-tcttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
35877055 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
35876956 |
T |
 |
| Q |
391 |
attttggaaatagtc |
405 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35876955 |
tttttggaaatagtc |
35876941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 36577720 - 36577773
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36577720 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
36577773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 26133414 - 26133362
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26133362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 42553642 - 42553694
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtct |
42553694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 18046352 - 18046297
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18046352 |
attaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18046297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 293 - 344
Target Start/End: Complemental strand, 31037744 - 31037693
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31037744 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 4203773 - 4203719
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
4203773 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
4203719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 5950173 - 5950227
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5950173 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
5950227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 14318042 - 14318096
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
14318042 |
ttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
14318096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 16038738 - 16038688
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtct |
16038688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 20690731 - 20690785
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20690731 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtct |
20690785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 292 - 346
Target Start/End: Complemental strand, 25779166 - 25779112
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25779166 |
attaggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagt |
25779112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 29366949 - 29366899
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29366899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 29692741 - 29692795
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29692741 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29692795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 29875728 - 29875674
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29875728 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29875674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 3850601 - 3850548
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
3850548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 293 - 346
Target Start/End: Complemental strand, 5614533 - 5614480
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
5614533 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5614480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 10744056 - 10744003
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
10744003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 286 - 347
Target Start/End: Original strand, 18046028 - 18046089
Alignment:
| Q |
286 |
ttaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18046028 |
ttaattaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
18046089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 19685015 - 19685068
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19685015 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19685068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 24781987 - 24782040
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24781987 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtc |
24782040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 27850372 - 27850323
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtc |
27850323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 30800492 - 30800545
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30800492 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
30800545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 30800852 - 30800799
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
30800799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 278 - 347
Target Start/End: Complemental strand, 35166175 - 35166107
Alignment:
| Q |
278 |
tttaacaattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| ||||| |||||||| |||||| |||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
35166175 |
tttaacaaataatt-ttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtc |
35166107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 39379237 - 39379290
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
39379237 |
taggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
39379290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 2217493 - 2217545
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
2217545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 2217855 - 2217803
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
2217803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 5614165 - 5614217
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
5614217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 7075571 - 7075623
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7075623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 10743723 - 10743775
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
10743775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 16038376 - 16038428
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16038428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 18258161 - 18258213
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtc |
18258213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 18633598 - 18633650
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18633650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 21124912 - 21124964
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
21124964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 23381948 - 23382000
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23381948 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
23382000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 24443379 - 24443431
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
24443431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 28213372 - 28213424
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
28213424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 28863509 - 28863561
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28863561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 29172887 - 29172835
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29172835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 29693091 - 29693039
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
29693039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 29875399 - 29875451
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtc |
29875451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 34125633 - 34125581
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtc |
34125581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 35167166 - 35167114
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35167114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 36578084 - 36578032
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
36578032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 38496783 - 38496731
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
38496731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 45138 - 45189
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
45189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 2032940 - 2032889
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtc |
2032889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 293 - 348
Target Start/End: Complemental strand, 10409329 - 10409274
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
10409329 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtct |
10409274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 15916286 - 15916337
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtc |
15916337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 28550827 - 28550878
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28550878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 28863838 - 28863787
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28863787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 29151516 - 29151567
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc |
29151567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 30888160 - 30888211
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
30888211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 33336026 - 33335975
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
33335975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 40029497 - 40029446
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
40029446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 1105151 - 1105097
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1105151 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1105097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 406
Target Start/End: Complemental strand, 6912855 - 6912745
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatttt |
395 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| |||||||||||||||| |||||||||||| |||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccatgcaaaatattttattttt |
6912756 |
T |
 |
| Q |
396 |
ggaaatagtcc |
406 |
Q |
| |
|
||||||||||| |
|
|
| T |
6912755 |
ggaaatagtcc |
6912745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 19565834 - 19565780
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19565834 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
19565780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 406
Target Start/End: Complemental strand, 20691094 - 20690984
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc-ttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatttt |
395 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||| |||||||||||||| |||| ||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtctttgtaattcttttttgttctttttggtccctgcaaaatattttgttttt |
20690995 |
T |
 |
| Q |
396 |
ggaaatagtcc |
406 |
Q |
| |
|
| ||||||||| |
|
|
| T |
20690994 |
gaaaatagtcc |
20690984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 20986090 - 20985977
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||| ||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
20985991 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20985990 |
tttggaaatagtcc |
20985977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 24443746 - 24443632
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | |
|
|
| T |
24443746 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattt |
24443647 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24443646 |
ttttggaaatagtcc |
24443632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 344
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 29172524 - 29172574
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29172574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 34125304 - 34125358
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34125304 |
ttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
34125358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 39379613 - 39379559
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
39379613 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
39379559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 40764781 - 40764668
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt |
40764682 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40764681 |
tttggaaatagtcc |
40764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 19685381 - 19685268
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | | |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattatttt |
19685282 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19685281 |
tttggaaatagtcc |
19685268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 40029140 - 40029189
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 40168010 - 40167957
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
40168010 |
taggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtc |
40167957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 42207240 - 42207293
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtc |
42207293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 293827 - 293879
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
293879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 1381612 - 1381560
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1381560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 2636669 - 2636721
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtct |
2636721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4736543 - 4736491
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
4736491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5917461 - 5917409
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5917409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 10408927 - 10408979
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10408979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 11799459 - 11799407
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtc |
11799407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 13990896 - 13990844
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
13990844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 15635708 - 15635656
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc |
15635656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 20660947 - 20660999
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
20660999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 26071290 - 26071342
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtc |
26071342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 26071613 - 26071565
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtc |
26071565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35928063 - 35928115
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35928115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 36973710 - 36973598
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||| ||||| |||||||| ||| || ||||||||||||||| ||||||||||||| || |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt |
36973611 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
36973610 |
ttgaaaatagtcc |
36973598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 37271707 - 37271655
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||| |||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtc |
37271655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 38170513 - 38170565
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
38170565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 292 - 406
Target Start/End: Original strand, 38554747 - 38554860
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||| |
|
|
| T |
38554747 |
attaggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtctctgtaaatttttttgttgtttttggttcatgcaaaatattttg |
38554844 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
38554845 |
tttttgaaaatagtcc |
38554860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 38786158 - 38786210
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
38786210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 40167785 - 40167837
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtc |
40167837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 40764414 - 40764466
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
40764466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 346
Target Start/End: Complemental strand, 1287042 - 1286995
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagt |
1286995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 6912497 - 6912548
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
6912548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 9588611 - 9588560
Alignment:
| Q |
297 |
gctaaaatatgattttag-tccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
9588560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 294 - 345
Target Start/End: Complemental strand, 17070865 - 17070814
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
17070865 |
taggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 23382297 - 23382246
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
23382246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 25561705 - 25561756
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
25561756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 26133183 - 26133234
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
26133234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 29151852 - 29151801
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
29151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 1104855 - 1104909
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
1104855 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
1104909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 4736286 - 4736332
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
4736286 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
4736332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 10830899 - 10830845
Alignment:
| Q |
294 |
taggctaaaatatgattttag-tccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| || ||||||||||||||| |
|
|
| T |
10830899 |
taggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtc |
10830845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 27916462 - 27916512
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtc |
27916512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 309 - 347
Target Start/End: Original strand, 28871711 - 28871749
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtc |
28871749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 29855614 - 29855664
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| |||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtc |
29855664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 36278078 - 36278132
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
36278078 |
ttaggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtc |
36278132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 37271356 - 37271410
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
37271356 |
ttaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc |
37271410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 42553942 - 42553896
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
42553942 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
42553896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 3851331 - 3851278
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtc |
3851278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 9179921 - 9179872
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 12144905 - 12144958
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
12144905 |
taggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtc |
12144958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 22540096 - 22540145
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||||||||||||| |||||| |
|
|
| T |
22540096 |
aggctaaaatatgattatggtccccgcaaatatgtctcatttttgtttta |
22540145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 27916761 - 27916712
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtct |
27916712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 38555085 - 38555033
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
38555085 |
taggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtc |
38555033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 9179592 - 9179644
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtc |
9179644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 9532532 - 9532484
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
9532484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 11799128 - 11799180
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtc |
11799180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 15635379 - 15635427
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtc |
15635427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 20416359 - 20416411
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtc |
20416411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 20985728 - 20985776
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
20985776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35876687 - 35876739
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
35876739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 40038858 - 40038810
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggtttta |
40038810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 309 - 348
Target Start/End: Complemental strand, 45430 - 45391
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
45430 |
ttttggtccctgcaaatatgtctcattttggttttggtct |
45391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || ||| |||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 371 - 406
Target Start/End: Original strand, 18258373 - 18258408
Alignment:
| Q |
371 |
ggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18258373 |
ggtccctgcaaaatattttgattttggaaatagtcc |
18258408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 21050575 - 21050626
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||| |||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtc |
21050626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 21050913 - 21050862
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtc |
21050862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 292 - 347
Target Start/End: Original strand, 28871633 - 28871688
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
28871633 |
attaggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtc |
28871688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 28871995 - 28871944
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||| |||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagt |
28871944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 293 - 344
Target Start/End: Original strand, 32108805 - 32108856
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| || |||| |||||| |
|
|
| T |
32108805 |
ttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta |
32108856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 1381538 - 1381504
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
1381538 |
ttttggtccctgcaaatatgtctcattttggtttt |
1381504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 5904074 - 5904120
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
5904074 |
ttgttgtttttgatccctgcaaaatattttgtttttgaaaatagtcc |
5904120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 336
Target Start/End: Complemental strand, 6244439 - 6244401
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattt |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
6244439 |
ctaaaatatgattttggtccctgcaaatatgactcattt |
6244401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 6912571 - 6912605
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
6912571 |
ttttggtccctgcaaatatgtctcattttggtttt |
6912605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 12145181 - 12145131
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtct |
12145131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 344
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||| ||||||||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 19565758 - 19565724
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
19565758 |
ttttggtccctgcaaatatgtctcattttggtttt |
19565724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 20985798 - 20985832
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
20985798 |
ttttggtccctgcaaatatgtctcattttggtttt |
20985832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 24443453 - 24443487
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
24443453 |
ttttggtccctgcaaatatgtctcattttggtttt |
24443487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 347
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 34125472 - 34125518
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
34125472 |
ttgtagtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
34125518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 35876761 - 35876795
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35876761 |
ttttggtccctgcaaatatgtctcattttggtttt |
35876795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 35928137 - 35928171
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35928137 |
ttttggtccctgcaaatatgtctcattttggtttt |
35928171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||| ||| || |||||||||||| ||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 37271633 - 37271599
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
37271633 |
ttttggtccctgcaaatatgtctcattttggtttt |
37271599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 344
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 38496417 - 38496470
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
38496417 |
ttaggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtc |
38496470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 402
Target Start/End: Complemental strand, 40038792 - 40038750
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaata |
402 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
40038792 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaata |
40038750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 40764488 - 40764522
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
40764488 |
ttttggtccctgcaaatatgtctcattttggtttt |
40764522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 344
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||| |||| |||||||||||||||| || ||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 327
Target Start/End: Complemental strand, 3938121 - 3938088
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3938121 |
taggctaaaatatgcttttagtccctgcaaatat |
3938088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 332
Target Start/End: Original strand, 17070534 - 17070571
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctc |
332 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctc |
17070571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 30888432 - 30888379
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||||| | | |||||| |||| ||||||||||||||| |
|
|
| T |
30888432 |
aggctaaaatatgattttagtatccgtaaatatatctcgttttggttttagtct |
30888379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 20418013 - 20417965
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtc |
20417965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 20683746 - 20683798
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtc |
20683798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Complemental strand, 27571189 - 27571157
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
27571189 |
aggctaaaatatgattttggtccctgcaaatat |
27571157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 28108159 - 28108111
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtc |
28108111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Complemental strand, 34911888 - 34911856
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
34911888 |
aggctaaaatatgattttggtccctgcaaatat |
34911856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 42596814 - 42596766
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtc |
42596766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 214)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 10631164 - 10631276
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgatt |
10631263 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10631264 |
ttggaaatagtcc |
10631276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 292 - 406
Target Start/End: Original strand, 8140430 - 8140546
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatatttt |
389 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
8140430 |
attaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatttt |
8140529 |
T |
 |
| Q |
390 |
gattttggaaatagtcc |
406 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
8140530 |
gtttttggaaatagtcc |
8140546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 3247197 - 3247310
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt |
3247296 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3247297 |
tttggaaatagtcc |
3247310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 19720711 - 19720824
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt |
19720810 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19720811 |
tttggaaatagtcc |
19720824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 299 - 390
Target Start/End: Original strand, 7350426 - 7350518
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttataaaaaaaattgttgtttttggtccctgcaaaatattttg |
7350518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 13260325 - 13260270
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13260325 |
attaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13260270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 48609598 - 48609543
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48609598 |
attaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 294 - 349
Target Start/End: Original strand, 48955712 - 48955767
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctt |
48955767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 289 - 347
Target Start/End: Complemental strand, 990386 - 990328
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
990386 |
attattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
990328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 15526363 - 15526250
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgtt |
15526264 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15526263 |
tttggaaatagtcc |
15526250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 19622652 - 19622706
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19622652 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19622706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 21391093 - 21391147
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21391093 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
21391147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 30322928 - 30323041
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgtt |
30323027 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30323028 |
tttggaaatagtcc |
30323041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 42482977 - 42483031
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42482977 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtct |
42483031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 50429212 - 50429158
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
50429212 |
ttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
50429158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 292 - 406
Target Start/End: Complemental strand, 10887602 - 10887486
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatatttt |
389 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
10887602 |
attaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatatttt |
10887503 |
T |
 |
| Q |
390 |
gattttggaaatagtcc |
406 |
Q |
| |
|
| ||||| ||||||||| |
|
|
| T |
10887502 |
gtttttgaaaatagtcc |
10887486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 12360969 - 12360856
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttgtt |
12360870 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
12360869 |
tttgaaaatagtcc |
12360856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 17984701 - 17984648
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctt |
17984648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 21383102 - 21383155
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
21383102 |
taggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc |
21383155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 24507844 - 24507731
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
24507745 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24507744 |
tttggaaatagtcc |
24507731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 35056530 - 35056642
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| || |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt |
35056629 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35056630 |
ttggaaatagtcc |
35056642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 40718110 - 40718222
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| || |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgttt |
40718209 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40718210 |
ttggaaatagtcc |
40718222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 45380636 - 45380524
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| || ||||||||||||||||| ||||||||||||| || |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt |
45380537 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45380536 |
ttggaaatagtcc |
45380524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 50799128 - 50799181
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
50799181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 6567497 - 6567445
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
6567445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 14007488 - 14007540
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
14007540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 288 - 347
Target Start/End: Complemental strand, 26191743 - 26191683
Alignment:
| Q |
288 |
aattatta-ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26191743 |
aattattatggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26191683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 289 - 406
Target Start/End: Original strand, 31060780 - 31060899
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatat |
386 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
31060780 |
attatttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatat |
31060879 |
T |
 |
| Q |
387 |
tttgattttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
31060880 |
tttgtttttggaaatagtcc |
31060899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 34002941 - 34002829
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||| | ||| |||||| |||||||||| |||||||||||| || |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaaatttttttgttggttttggtccctacaaaatattttgttt |
34002842 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
34002841 |
ttgaaaatagtcc |
34002829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 294 - 346
Target Start/End: Complemental strand, 41358665 - 41358613
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41358665 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
41358613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 45290456 - 45290508
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
45290508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 26442563 - 26442614
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26442614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 284 - 347
Target Start/End: Complemental strand, 32454306 - 32454243
Alignment:
| Q |
284 |
aattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
32454306 |
aattatttattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtc |
32454243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 32626528 - 32626579
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
32626579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 44641432 - 44641381
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
44641381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 26324949 - 26324895
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
26324949 |
taggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtct |
26324895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 30323296 - 30323242
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30323296 |
ttaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
30323242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 35005747 - 35005693
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35005747 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35005693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 38164296 - 38164183
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
38164197 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38164196 |
tttggaaatagtcc |
38164183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 39747837 - 39747723
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
39747837 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattttgt |
39747738 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39747737 |
ttttggaaatagtcc |
39747723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 45380269 - 45380323
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
45380269 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
45380323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 47819597 - 47819484
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
47819498 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47819497 |
tttggaaatagtcc |
47819484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 11822367 - 11822314
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtc |
11822314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 13770487 - 13770540
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13770487 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
13770540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 16026940 - 16026887
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
16026940 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
16026887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 18473270 - 18473323
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18473270 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18473323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 22919682 - 22919735
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22919682 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22919735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 24653802 - 24653914
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| || |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt |
24653901 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24653902 |
ttggaaatagtcc |
24653914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 26324583 - 26324636
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26324583 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
26324636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 35056896 - 35056843
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35056896 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
35056843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 46868225 - 46868278
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46868225 |
aggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtct |
46868278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 1810926 - 1810978
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1810978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 7867358 - 7867306
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtc |
7867306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 287 - 347
Target Start/End: Original strand, 10887224 - 10887284
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
10887224 |
taatttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
10887284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 11822003 - 11822055
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
11822055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 18302388 - 18302336
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18302336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 18473596 - 18473544
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
18473544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 26061955 - 26062007
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
26062007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 29072496 - 29072548
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
29072548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 32729050 - 32728998
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
32728998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 33000670 - 33000618
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
33000618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 33234545 - 33234597
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
33234597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 33379887 - 33379939
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
33379939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 41358368 - 41358420
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
41358420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 41881092 - 41881144
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtc |
41881144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 45368489 - 45368541
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
45368541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 292 - 344
Target Start/End: Complemental strand, 45638898 - 45638846
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
45638898 |
attaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 48609235 - 48609287
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtc |
48609287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 3679986 - 3679935
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc |
3679935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 292 - 347
Target Start/End: Original strand, 4789304 - 4789359
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| |||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4789304 |
attagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
4789359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 7001897 - 7001846
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7001846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 299 - 346
Target Start/End: Complemental strand, 15335292 - 15335245
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
15335245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 16060885 - 16060834
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
16060834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 299 - 346
Target Start/End: Original strand, 18899842 - 18899889
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18899889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 24977778 - 24977829
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24977829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 299 - 346
Target Start/End: Complemental strand, 26062255 - 26062208
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagt |
26062208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 35307714 - 35307765
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35307765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 35308111 - 35308060
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
35308060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 38136981 - 38136930
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
38136930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 46868577 - 46868526
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
46868526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 3753214 - 3753264
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3753264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 7867126 - 7867180
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
7867126 |
ttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
7867180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 16083046 - 16083100
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtctt |
16083100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 24654168 - 24654118
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 27521577 - 27521627
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
27521627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 343
Target Start/End: Original strand, 33067345 - 33067395
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33067345 |
ttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 39303675 - 39303725
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtc |
39303725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 44641079 - 44641129
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44641129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 45290823 - 45290769
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
45290823 |
ttaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc |
45290769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 13259986 - 13260039
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtc |
13260039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 15211510 - 15211563
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtct |
15211563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 17984332 - 17984385
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtct |
17984385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 28507460 - 28507407
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
28507460 |
taggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtc |
28507407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 34002634 - 34002687
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggttttggtct |
34002687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 34808195 - 34808248
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
34808195 |
taggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtc |
34808248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 45368847 - 45368798
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtc |
45368798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 47819230 - 47819283
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
47819230 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
47819283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 990087 - 990139
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
990139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 3679625 - 3679677
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
3679677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 3753573 - 3753521
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
3753521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 10631529 - 10631477
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
10631477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 289 - 345
Target Start/End: Original strand, 12360596 - 12360652
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
12360596 |
attaataggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag |
12360652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 12361010 - 12361062
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||| || ||| |||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtc |
12361062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 390
Target Start/End: Complemental strand, 15058767 - 15058671
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag-tcttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||| || ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttcatgtaaaaaaaattgttgtttttggtcccggcaaaatattttg |
15058671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 18900130 - 18900082
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
18900082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19623018 - 19622966
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
19622966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 19721071 - 19721023
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
19721023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 26442900 - 26442848
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc |
26442848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 29688429 - 29688377
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
29688377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 31258338 - 31258390
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
31258390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 33045691 - 33045639
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
33045639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 33234912 - 33234800
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnt-tgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| ||||||| | ||| | ||||||||||| |||| ||||||||||||| || |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattttgttt |
33234813 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
33234812 |
ttgaaaatagtcc |
33234800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35005443 - 35005495
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
35005495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 38150851 - 38150899
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
38150899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 38151212 - 38151100
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | || |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt |
38151113 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38151112 |
ttggaaatagtcc |
38151100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 52254182 - 52254234
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
52254234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 4323829 - 4323880
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtct |
4323880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 294 - 349
Target Start/End: Original strand, 22674201 - 22674256
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
|||||||||||||| ||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
22674201 |
taggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtctt |
22674256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 26191359 - 26191410
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
26191410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 29072862 - 29072811
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtc |
29072811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 37545628 - 37545679
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc |
37545679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 41738796 - 41738847
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtc |
41738847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 406
Target Start/End: Original strand, 44157696 - 44157807
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgattt |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||| ||||| ||||||||||||| ||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttagtccctgcaaaatattttgtttt |
44157795 |
T |
 |
| Q |
395 |
tggaaatagtcc |
406 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
44157796 |
tgaaaatagtcc |
44157807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 48956066 - 48956015
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
48956015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 52254479 - 52254428
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
52254428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 328
Target Start/End: Complemental strand, 1811237 - 1811203
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1811237 |
taggctaaaatatgattttagtccctgcaaatatg |
1811203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 3247565 - 3247511
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3247565 |
ttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3247511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 4360627 - 4360577
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag |
4360577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 7819105 - 7819051
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||| ||| ||||||||||||||| |
|
|
| T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtct |
7819051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 15058419 - 15058469
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtc |
15058469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 15516579 - 15516633
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
15516579 |
ttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtc |
15516633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 344
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 18928141 - 18928091
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtc |
18928091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 22919980 - 22919926
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||| |||| ||||||||| |
|
|
| T |
22919980 |
ttaggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtc |
22919926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 24649663 - 24649609
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| |||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
24649663 |
ttaggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
24649609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 24978056 - 24978010
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
24978056 |
ttgttgtttttggtccttgcaaaatattttgtttttggaaatagtcc |
24978010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 32420099 - 32420149
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
32420149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 344
Target Start/End: Complemental strand, 4324163 - 4324118
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggtttta |
4324118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 22953258 - 22953307
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtc |
22953307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 26207280 - 26207329
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
26207329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 32906242 - 32906189
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||| ||||| |||||||| |
|
|
| T |
32906242 |
taggttaaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 291 - 344
Target Start/End: Complemental strand, 33067735 - 33067682
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||| |||||||||| ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33067735 |
tattaagctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 49073690 - 49073739
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 50428872 - 50428921
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 8140800 - 8140748
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||| |||||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtc |
8140748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 16026572 - 16026686
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc---ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||| |||||||||||||| || ||||||||||||||||| |||||||||| | |
|
|
| T |
16026572 |
aggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccctttaaaaaaaaaattgttgtttttggtccctgcaaaatattattt |
16026671 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16026672 |
ttttggaaatagtcc |
16026686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 18079397 - 18079449
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| | |||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtc |
18079449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 20756022 - 20756070
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| |||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtc |
20756070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
25658062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 31061152 - 31061100
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtc |
31061100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 31258699 - 31258651
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtc |
31258651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 33000305 - 33000417
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||| ||||||| | ||| ||||||||||||||||| |||||||||| | || |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattattttt |
33000404 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33000405 |
ttggaaatagtcc |
33000417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 294 - 338
Target Start/End: Original strand, 36912851 - 36912895
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttg |
338 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
36912851 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 343
Target Start/End: Original strand, 37624745 - 37624793
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||| |||||||||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 38163934 - 38163982
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
38163982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 44158043 - 44157991
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtc |
44157991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 293 - 328
Target Start/End: Complemental strand, 2604189 - 2604154
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2604189 |
ttaggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 293 - 348
Target Start/End: Complemental strand, 4617398 - 4617343
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||| || ||||||||||||||| |
|
|
| T |
4617398 |
ttaggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtct |
4617343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 12158690 - 12158741
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtc |
12158741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttg |
338 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Complemental strand, 19622950 - 19622907
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
19622950 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
19622907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 20948755 - 20948806
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||| ||| |||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtc |
20948806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 24507479 - 24507530
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
24507530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 34383244 - 34383193
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| | |||||||||||||| |
|
|
| T |
34383244 |
ggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtc |
34383193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 37625026 - 37624975
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| || |||||||| |||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtct |
37624975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 39025381 - 39025271
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgattt |
394 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||| ||| |||||||||||||| | | ||||||||||||||||| |||| |||||||| ||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccctataaaaaaaattgttgtttttggtccctgcaagatattttgtttt |
39025283 |
T |
 |
| Q |
395 |
tggaaatagtcc |
406 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
39025282 |
tgaaaatagtcc |
39025271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 41739122 - 41739072
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtc |
41739072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 45638580 - 45638631
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
45638631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 347
Target Start/End: Original strand, 2939934 - 2939980
Alignment:
| Q |
301 |
aaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
2939980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 3247489 - 3247455
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
3247489 |
ttttggtccctgcaaatatgtctcattttggtttt |
3247455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 8364682 - 8364728
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
8364682 |
ttgttgtttttggtccctgcaaaatattttacttttgaaaatagtcc |
8364728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 343
Target Start/End: Complemental strand, 8364919 - 8364869
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
8364919 |
ttaggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 16026865 - 16026831
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
16026865 |
ttttggtccctgcaaatatgtctcattttggtttt |
16026831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 347
Target Start/End: Original strand, 18302070 - 18302104
Alignment:
| Q |
313 |
agtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtc |
18302104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 405
Target Start/End: Complemental strand, 18928073 - 18928031
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
18928073 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtc |
18928031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 19721001 - 19720967
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
19721001 |
ttttggtccctgcaaatatgtctcattttggtttt |
19720967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 24507552 - 24507586
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
24507552 |
ttttggtccctgcaaatatgtctcattttggtttt |
24507586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 24654094 - 24654060
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
24654094 |
ttttggtccctgcaaatatgtctcattttggtttt |
24654060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 24977852 - 24977886
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
24977852 |
ttttggtccctgcaaatatgtctcattttggtttt |
24977886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 30323220 - 30323186
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
30323220 |
ttttggtccctgcaaatatgtctcattttggtttt |
30323186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 31061078 - 31061044
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
31061078 |
ttttggtccctgcaaatatgtctcattttggtttt |
31061044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 299 - 337
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcatttt |
337 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 33000596 - 33000562
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
33000596 |
ttttggtccctgcaaatatgtctcattttggtttt |
33000562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 33045352 - 33045406
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
33045352 |
ttaggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtc |
33045406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 364 - 406
Target Start/End: Original strand, 34492303 - 34492345
Alignment:
| Q |
364 |
tgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
34492303 |
tgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
34492345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 35056821 - 35056787
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35056821 |
ttttggtccctgcaaatatgtctcattttggtttt |
35056787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 36912914 - 36912960
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||||| ||||||||| |
|
|
| T |
36912914 |
ttgttgtttttggtccctgtaaaatattttgtttttgaaaatagtcc |
36912960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 38136908 - 38136874
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
38136908 |
ttttggtccctgcaaatatgtctcattttggtttt |
38136874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 38150921 - 38150955
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
38150921 |
ttttggtccctgcaaatatgtctcattttggtttt |
38150955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 38164004 - 38164038
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
38164004 |
ttttggtccctgcaaatatgtctcattttggtttt |
38164038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 40718401 - 40718367
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
40718401 |
ttttggtccctgcaaatatgtctcattttggtttt |
40718367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 45380345 - 45380379
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
45380345 |
ttttggtccctgcaaatatgtctcattttggtttt |
45380379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 45638653 - 45638687
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
45638653 |
ttttggtccctgcaaatatgtctcattttggtttt |
45638687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 47819305 - 47819339
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
47819305 |
ttttggtccctgcaaatatgtctcattttggtttt |
47819339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 51986308 - 51986354
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
51986308 |
ttgttgtttttggtccctgcaaaatattttatttttgaaaatagtcc |
51986354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 4565338 - 4565285
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||||||| |||| |||||||| |
|
|
| T |
4565338 |
taggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtc |
4565285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 21383430 - 21383377
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| ||||||||| |||||||| |
|
|
| T |
21383430 |
taggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtc |
21383377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 21391371 - 21391322
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||| |||| |||||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtct |
21391322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 338
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttg |
338 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 327
Target Start/End: Complemental strand, 27264277 - 27264244
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
27264277 |
taggctaaaatatgattttggtccctgcaaatat |
27264244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 331
Target Start/End: Complemental strand, 32035790 - 32035753
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtct |
331 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
32035790 |
taggctaaaatatggttttggtccctgcaaatatgtct |
32035753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 46183686 - 46183735
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
46183735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 49923820 - 49923767
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| || ||||| |||||||| |
|
|
| T |
49923820 |
taggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtc |
49923767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 378 - 406
Target Start/End: Complemental strand, 10631311 - 10631283
Alignment:
| Q |
378 |
gcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10631311 |
gcaaaatattttgattttggaaatagtcc |
10631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 16060595 - 16060646
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 343
Target Start/End: Original strand, 39025112 - 39025156
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 39747473 - 39747524
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||| |||||||| ||||| |||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtc |
39747524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 343
Target Start/End: Complemental strand, 46184051 - 46184007
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||| |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggtttt |
46184007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Original strand, 47038865 - 47038897
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
47038865 |
aggctaaaatatgtttttagtccctgcaaatat |
47038897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 2e-22; HSPs: 191)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 286 - 406
Target Start/End: Original strand, 10337109 - 10337231
Alignment:
| Q |
286 |
ttaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaa |
383 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
10337109 |
ttaatttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaa |
10337208 |
T |
 |
| Q |
384 |
tattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
10337209 |
tattttgtttttggaaatagtcc |
10337231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 2728231 - 2728344
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgtt |
2728330 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2728331 |
tttggaaatagtcc |
2728344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 20984511 - 20984398
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgtt |
20984412 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20984411 |
tttggaaatagtcc |
20984398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 24187898 - 24187846
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
24187846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 9496339 - 9496453
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttgt |
9496438 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9496439 |
ttttggaaatagtcc |
9496453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 35097326 - 35097440
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
35097326 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgt |
35097425 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35097426 |
ttttggaaatagtcc |
35097440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 35347000 - 35346886
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
35347000 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgt |
35346901 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35346900 |
ttttggaaatagtcc |
35346886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 32725906 - 32726019
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgtt |
32726005 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32726006 |
tttggaaatagtcc |
32726019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 33526415 - 33526361
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526415 |
ttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
33526361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 7272419 - 7272472
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtct |
7272472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 9175011 - 9175124
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtcccagcaaaatattttgtt |
9175110 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
9175111 |
tttgaaaatagtcc |
9175124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 17073805 - 17073858
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17073805 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
17073858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 17574465 - 17574412
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17574465 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
17574412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 29158352 - 29158405
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29158352 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
29158405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 11976372 - 11976484
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | || |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattattttt |
11976471 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11976472 |
ttggaaatagtcc |
11976484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 14238750 - 14238802
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
14238802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 19494117 - 19494169
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19494117 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19494169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 289 - 406
Target Start/End: Complemental strand, 34963671 - 34963552
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatat |
386 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||||||||| ||||||||||||| || || |||||||||||||| ||||||||| |
|
|
| T |
34963671 |
attatttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaaatat |
34963572 |
T |
 |
| Q |
387 |
tttgattttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
34963571 |
tttgtttttggaaatagtcc |
34963552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 289 - 406
Target Start/End: Original strand, 6469273 - 6469392
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag-tcttgt-nnnnnnnnttgttgtttttggtccccgcaaaatat |
386 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||| ||| |||||||||||| || ||| ||||||||||||||||| ||||||||| |
|
|
| T |
6469273 |
attattaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatat |
6469372 |
T |
 |
| Q |
387 |
tttgattttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||| ||||||||| |
|
|
| T |
6469373 |
tttgcttttgaaaatagtcc |
6469392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 16789074 - 16789125
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
16789125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 25131110 - 25131161
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
25131161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 42430120 - 42430069
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42430069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 3512269 - 3512215
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3512269 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3512215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 24955013 - 24954959
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24955013 |
ttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
24954959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 28346393 - 28346506
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttgtt |
28346492 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28346493 |
tttggaaatagtcc |
28346506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 32040072 - 32040126
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
32040072 |
ttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtc |
32040126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 37536085 - 37536198
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttgtt |
37536184 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37536185 |
tttggaaatagtcc |
37536198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 1525808 - 1525861
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtct |
1525861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 1526174 - 1526121
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1526174 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
1526121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 5357421 - 5357474
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5357421 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
5357474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 8094477 - 8094530
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8094477 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtc |
8094530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 402
Target Start/End: Original strand, 10776150 - 10776255
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||| | ||||| || |||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaatttttttttttgtttttggtccctgcaaaattttttgtttttg |
10776249 |
T |
 |
| Q |
397 |
gaaata |
402 |
Q |
| |
|
||||| |
|
|
| T |
10776250 |
aaaata |
10776255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 28399037 - 28398984
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
28399037 |
taggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtc |
28398984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 38930665 - 38930616
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 40492958 - 40493011
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtc |
40493011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 1408354 - 1408302
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
1408302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 3511903 - 3512018
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
3511903 |
ttaggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
3512002 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3512003 |
tttttggaaatagtcc |
3512018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 291 - 347
Target Start/End: Complemental strand, 4710225 - 4710169
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4710225 |
tattaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
4710169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 7420229 - 7420281
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
7420281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 8298976 - 8298924
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8298924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 11019519 - 11019571
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
11019571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 14239081 - 14239029
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
14239029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 16644045 - 16643993
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtc |
16643993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19494414 - 19494362
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
19494362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 22650463 - 22650515
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
22650515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 22917563 - 22917615
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22917615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 24815069 - 24815017
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtc |
24815017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 25600228 - 25600280
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
25600228 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25600280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 27341592 - 27341540
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
27341540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 32418317 - 32418369
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
32418369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 43477162 - 43477214
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
43477214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 1778564 - 1778615
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
1778615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 7186004 - 7185953
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
7185953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 8298587 - 8298638
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8298638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 13232562 - 13232451
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgattt |
394 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||| | ||||||||||| ||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttctgtaaattttttttgttatttttggtccctgaaaaatattttgtttt |
13232463 |
T |
 |
| Q |
395 |
tggaaatagtcc |
406 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
13232462 |
tgaaaatagtcc |
13232451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 14489073 - 14489022
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
14489022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 14495068 - 14495119
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14495119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 15719656 - 15719707
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtc |
15719707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 16789369 - 16789318
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16789318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 406
Target Start/End: Complemental strand, 24090487 - 24090376
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgattt |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||||||||||||| ||| ||||||||||||||||| |||||||||||| ||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaattgttgtttttggtccctacaaaatattttgtttt |
24090388 |
T |
 |
| Q |
395 |
tggaaatagtcc |
406 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
24090387 |
tgaaaatagtcc |
24090376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 29487750 - 29487801
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtc |
29487801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 291 - 405
Target Start/End: Original strand, 32195275 - 32195390
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatatttt |
389 |
Q |
| |
|
|||| |||||||||||| |||| |||||| ||||||||||||||||| ||||||||| | | || |||||||||||||| |||||||||||| |
|
|
| T |
32195275 |
tatttggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtctctataattttttttattgtttttggtccctgcaaaatatttt |
32195374 |
T |
 |
| Q |
390 |
gattttggaaatagtc |
405 |
Q |
| |
|
| ||||| |||||||| |
|
|
| T |
32195375 |
gtttttgaaaatagtc |
32195390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 35346629 - 35346680
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35346680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 38930301 - 38930352
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38930352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 42133154 - 42133103
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
42133103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 4473701 - 4473755
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
4473701 |
ttaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
4473755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 289 - 347
Target Start/End: Complemental strand, 6469674 - 6469616
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||| | |||||||||||||| |
|
|
| T |
6469674 |
attattaggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtc |
6469616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 10776499 - 10776449
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10776449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 11019860 - 11019806
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
11019860 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
11019806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 11976739 - 11976685
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
11976739 |
ttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
11976685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 16643658 - 16643712
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
16643658 |
ttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
16643712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 18549199 - 18549253
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
18549199 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtct |
18549253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 405
Target Start/End: Complemental strand, 20278060 - 20277946
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||| ||| ||||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20278060 |
ttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttg |
20277961 |
T |
 |
| Q |
391 |
attttggaaatagtc |
405 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
20277960 |
tttttgaaaatagtc |
20277946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 405
Target Start/End: Complemental strand, 21064687 - 21064573
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||| ||| ||||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
21064687 |
ttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttg |
21064588 |
T |
 |
| Q |
391 |
attttggaaatagtc |
405 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
21064587 |
tttttgaaaatagtc |
21064573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 404
Target Start/End: Original strand, 28323848 - 28323958
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| || ||||||||||||| | | | ||||||||||||||||| ||||||||||||| || |
|
|
| T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccctttaaaaaaaattgttgtttttggtccctgcaaaatattttgttt |
28323947 |
T |
 |
| Q |
394 |
ttggaaatagt |
404 |
Q |
| |
|
||| ||||||| |
|
|
| T |
28323948 |
ttgaaaatagt |
28323958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 28346761 - 28346707
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28346761 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
28346707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 7420591 - 7420478
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtc |
7420492 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7420491 |
tttggaaatagtcc |
7420478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 8094843 - 8094790
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
8094790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 18549571 - 18549522
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtc |
18549522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 406
Target Start/End: Complemental strand, 28497616 - 28497507
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnt-tgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||| | ||| | |||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaatttttatgttgtttttggtccctgaaaaatattttgtttttg |
28497517 |
T |
 |
| Q |
397 |
gaaatagtcc |
406 |
Q |
| |
|
||||||||| |
|
|
| T |
28497516 |
aaaatagtcc |
28497507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 32726273 - 32726220
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
32726220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 33636320 - 33636373
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
33636320 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
33636373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 1685117 - 1685165
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1685165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4017301 - 4017249
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
4017249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 5357762 - 5357710
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctt |
5357710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 360 - 404
Target Start/End: Complemental strand, 10540714 - 10540670
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagt |
404 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
10540714 |
ttgttgtttttggtccctgcaaaatattttgtttttggaaatagt |
10540670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 13232201 - 13232249
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
13232249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 287 - 347
Target Start/End: Original strand, 14496807 - 14496867
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
14496807 |
taattataaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtc |
14496867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 14847828 - 14847876
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtc |
14847876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 20984145 - 20984197
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
20984197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 27117977 - 27117929
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 28497254 - 28497306
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtc |
28497306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 29488111 - 29488059
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
29488059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 34963299 - 34963351
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
34963351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 291 - 347
Target Start/End: Complemental strand, 40066825 - 40066769
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
40066825 |
tatttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtc |
40066769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 40844532 - 40844484
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtc |
40844484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 2728597 - 2728546
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
2728546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 344
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 7272751 - 7272700
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtc |
7272700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 7326421 - 7326370
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
7326370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 10337453 - 10337398
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
10337453 |
attaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
10337398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 344
Target Start/End: Complemental strand, 13155254 - 13155203
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||| ||||||||||| |
|
|
| T |
13155254 |
ttaggctaaaatatggtttttgttcctgcaaatatgtctcgttttggtttta |
13155203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 328
Target Start/End: Complemental strand, 21509921 - 21509886
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21509921 |
ttaggctaaaatatgattttagtccctgcaaatatg |
21509886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 25131447 - 25131396
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
25131396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 294 - 337
Target Start/End: Complemental strand, 25702811 - 25702768
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcatttt |
337 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
25702811 |
taggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 29158669 - 29158618
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtc |
29158618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 342
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttt |
342 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 404
Target Start/End: Original strand, 33652193 - 33652300
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||| | ||| || ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgtaaattttttttgttgtttttggtccctgcaaaatattttatttttg |
33652292 |
T |
 |
| Q |
397 |
gaaatagt |
404 |
Q |
| |
|
||||||| |
|
|
| T |
33652293 |
aaaatagt |
33652300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 35097692 - 35097641
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35097641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 344
Target Start/End: Complemental strand, 35345620 - 35345569
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
35345620 |
ttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 40066496 - 40066547
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagt |
40066547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 40844156 - 40844207
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
40844207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 6146517 - 6146567
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6146567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 6146948 - 6146898
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
6146898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 15930933 - 15930983
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| |||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtc |
15930983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 347
Target Start/End: Original strand, 24814710 - 24814756
Alignment:
| Q |
301 |
aaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
24814756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 25702578 - 25702624
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
25702578 |
ttgttgtttttggtccatgcaaaatattttgtttttggaaatagtcc |
25702624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 27117750 - 27117804
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
27117750 |
ttaggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc |
27117804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 291 - 348
Target Start/End: Complemental strand, 2356253 - 2356196
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||| |||||||||||||| | | |||||||||||||| ||||||||||||||| |
|
|
| T |
2356253 |
tattaggttaaaatatgattttgattcatgcaaatatgtctcgttttggttttagtct |
2356196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 2811778 - 2811729
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtct |
2811729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 7326084 - 7326137
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
7326084 |
taggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtc |
7326137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 10872914 - 10873027
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| ||||||||||||| | ||| ||||||||||| ||||| ||||||||||||| | |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttagtccctgcaaaatattttgtt |
10873013 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
10873014 |
tttgaaaatagtcc |
10873027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 14488715 - 14488768
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtct |
14488768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 406
Target Start/End: Complemental strand, 14848186 - 14848078
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnt-tgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| ||||||||||||| | || | |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagtccccgtaaaatttttgtgttgtttttggtccctgcaaaatattttgtttttg |
14848088 |
T |
 |
| Q |
397 |
gaaatagtcc |
406 |
Q |
| |
|
||||||||| |
|
|
| T |
14848087 |
aaaatagtcc |
14848078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 19962993 - 19963046
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| | ||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
19962993 |
taggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtc |
19963046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 21125718 - 21125767
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 28258243 - 28258190
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
28258243 |
taggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtc |
28258190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 43727431 - 43727383
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtc |
43727383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 44997930 - 44997979
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||| ||||| |
|
|
| T |
44997930 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 3680802 - 3680754
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4474045 - 4473993
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
4473993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 9496724 - 9496672
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
9496672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 10540783 - 10540731
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
10540731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 315 - 347
Target Start/End: Complemental strand, 13796577 - 13796545
Alignment:
| Q |
315 |
tccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13796577 |
tccctgcaaatatgtctcattttggttttagtc |
13796545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 20277691 - 20277743
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
20277743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 21064318 - 21064370
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
21064370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 24187568 - 24187620
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
24187620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 25600598 - 25600546
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtc |
25600546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 28324182 - 28324130
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtc |
28324130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 1162909 - 1162960
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtc |
1162960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 293 - 328
Target Start/End: Complemental strand, 4376013 - 4375978
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4376013 |
ttaggctaaaatatggttttagtccctgcaaatatg |
4375978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 4621354 - 4621303
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtc |
4621303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Complemental strand, 7326351 - 7326308
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
7326351 |
ttgtttttggtccctgtaaaatattttgtttttggaaatagtcc |
7326308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 293 - 348
Target Start/End: Complemental strand, 9175374 - 9175319
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||| ||||||||| |||| ||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
9175374 |
ttaggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtct |
9175319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 10873280 - 10873229
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtc |
10873229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 14495389 - 14495339
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| | |||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtc |
14495339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 371 - 406
Target Start/End: Original strand, 20984356 - 20984391
Alignment:
| Q |
371 |
ggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20984356 |
ggtccctgcaaaatattttgattttggaaatagtcc |
20984391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 21126025 - 21125970
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||| ||| |||||||||||||| |
|
|
| T |
21126025 |
attaggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtc |
21125970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 33526052 - 33526103
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
33526103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 344
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 37536419 - 37536368
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
37536368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 2728524 - 2728490
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2728524 |
ttttggtccctgcaaatatgtctcattttggtttt |
2728490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 3512193 - 3512159
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
3512193 |
ttttggtccctgcaaatatgtctcattttggtttt |
3512159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 4709979 - 4710013
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
4709979 |
ttttggtccctgcaaatatgtctcattttggtttt |
4710013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 7326159 - 7326193
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
7326159 |
ttttggtccctgcaaatatgtctcattttggtttt |
7326193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 7420303 - 7420337
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggtttt |
7420337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 7578527 - 7578477
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| | ||||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagtc |
7578477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 9496650 - 9496616
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
9496650 |
ttttggtccctgcaaatatgtctcattttggtttt |
9496616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 9832280 - 9832326
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
9832280 |
ttgttgtttttggtcccttcaaaatattttgtttttgaaaatagtcc |
9832326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 10540446 - 10540500
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
10540446 |
ttaggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtc |
10540500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 11019593 - 11019627
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
11019593 |
ttttggtccctgcaaatatgtctcattttggtttt |
11019627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 11976663 - 11976629
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
11976663 |
ttttggtccctgcaaatatgtctcattttggtttt |
11976629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 13232271 - 13232305
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggtttt |
13232305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 344
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 14495233 - 14495187
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
14495233 |
ttgtagtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
14495187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 20984219 - 20984253
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
20984219 |
ttttggtccctgcaaatatgtctcattttggtttt |
20984253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||| |||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 28346685 - 28346651
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28346685 |
ttttggtccctgcaaatatgtctcattttggtttt |
28346651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 32726198 - 32726164
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
32726198 |
ttttggtccctgcaaatatgtctcattttggtttt |
32726164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 34963373 - 34963407
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
34963373 |
ttttggtccctgcaaatatgtctcattttggtttt |
34963407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 35097619 - 35097585
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35097619 |
ttttggtccctgcaaatatgtctcattttggtttt |
35097585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 37536346 - 37536312
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
37536346 |
ttttggtccctgcaaatatgtctcattttggtttt |
37536312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 360 - 405
Target Start/End: Original strand, 5357489 - 5357534
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
|||||||||||||| || ||||||||||||| ||||| |||||||| |
|
|
| T |
5357489 |
ttgttgtttttggttcctgcaaaatattttgtttttgaaaatagtc |
5357534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 360 - 401
Target Start/End: Complemental strand, 8298909 - 8298868
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaat |
401 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
8298909 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaat |
8298868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 406
Target Start/End: Original strand, 13779216 - 13779261
Alignment:
| Q |
361 |
tgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||| ||||||||| |
|
|
| T |
13779216 |
tgttgtttttggtctctgcaaaatattttgtttttgaaaatagtcc |
13779261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 360 - 405
Target Start/End: Complemental strand, 13796530 - 13796485
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| | |||||| |
|
|
| T |
13796530 |
ttgttgtttttggtccctgcaaaatattttgtttttgaacatagtc |
13796485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 15719980 - 15719931
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
15719980 |
aggctaaaatataattttagtttctgcaaatatgtcttgttttggtttta |
15719931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 31445464 - 31445411
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
31445464 |
aggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtct |
31445411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 35115641 - 35115592
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
35115641 |
taggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 35143846 - 35143793
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| ||| || ||||||| ||| |||||||||||||| |
|
|
| T |
35143846 |
taggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtc |
35143793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 328
Target Start/End: Original strand, 39439923 - 39439956
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
39439923 |
aggctaaaatatgattttggtccctgcaaatatg |
39439956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtt |
341 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 345
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag |
13779483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 329
Target Start/End: Complemental strand, 23360735 - 23360703
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgt |
329 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
23360735 |
gctaaaatatgattttaatccctgcaaatatgt |
23360703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 328
Target Start/End: Original strand, 28398756 - 28398788
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatg |
28398788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Complemental strand, 36589447 - 36589415
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
36589447 |
aggctaaaatatgattttagttcctgcaaatat |
36589415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 42429757 - 42429808
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| |||| ||||||||||||| |
|
|
| T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcctca-tttggttttagtc |
42429808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 221)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 293 - 406
Target Start/End: Complemental strand, 15979704 - 15979590
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||||||| |||||||||||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
15979704 |
ttaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttgt |
15979605 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15979604 |
ttttggaaatagtcc |
15979590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 293 - 406
Target Start/End: Complemental strand, 51550449 - 51550334
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
51550449 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaaatattttg |
51550350 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51550349 |
cttttggaaatagtcc |
51550334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 47336583 - 47336469
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
47336583 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgt |
47336484 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47336483 |
ttttggaaatagtcc |
47336469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 291 - 347
Target Start/End: Original strand, 3830129 - 3830185
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3830129 |
tattaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
3830185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 284 - 406
Target Start/End: Original strand, 28452135 - 28452259
Alignment:
| Q |
284 |
aattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc-ttgtnnnnnnnn-ttgttgtttttggtccccgcaa |
381 |
Q |
| |
|
|||||| | ||||||||||||||| |||| |||| ||||||||||||| |||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
28452135 |
aattaagttttaggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaa |
28452234 |
T |
 |
| Q |
382 |
aatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
28452235 |
aatattttgtttttggaaatagtcc |
28452259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 863278 - 863393
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |||| |||||||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
863278 |
ttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
863377 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
863378 |
tttttgaaaatagtcc |
863393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 292 - 347
Target Start/End: Original strand, 34238594 - 34238649
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34238594 |
attaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
34238649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 22008525 - 22008638
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| | ||| |||||||||||||||| |||||||||||| | |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattttttt |
22008624 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22008625 |
tttggaaatagtcc |
22008638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 22016043 - 22016156
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| | ||| |||||||||||||||| |||||||||||| | |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattttttt |
22016142 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22016143 |
tttggaaatagtcc |
22016156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 39288572 - 39288625
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtct |
39288625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 9261789 - 9261901
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaaatattttgttt |
9261888 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
9261889 |
ttgaaaatagtcc |
9261901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 287 - 347
Target Start/End: Original strand, 22155920 - 22155980
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
22155920 |
taatttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
22155980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 26090078 - 26089966
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| | ||||||||||| || |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgtaaaatattttgttt |
26089979 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26089978 |
ttggaaatagtcc |
26089966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 30130156 - 30130208
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30130156 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
30130208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 30268504 - 30268556
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
30268556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 405
Target Start/End: Original strand, 38232240 - 38232354
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt---nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| ||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
38232339 |
T |
 |
| Q |
391 |
attttggaaatagtc |
405 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
38232340 |
tttttgaaaatagtc |
38232354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 39436717 - 39436769
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39436769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 40545836 - 40545788
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtc |
40545788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 45320980 - 45320928
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
45320928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 29445954 - 29446005
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
29446005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 53701663 - 53701612
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
53701612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 474043 - 474156
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||| ||||||||||||| ||||||||||||| | |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttggtgtttttggtccctgcaaaatattttgtt |
474142 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
474143 |
tttggaaatagtcc |
474156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 3151747 - 3151801
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3151747 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 3152114 - 3152060
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3152114 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3152060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 3830519 - 3830465
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3830519 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3830465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 12740904 - 12740958
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
12740904 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12740958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 13514580 - 13514526
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||| |||||||||||||| |
|
|
| T |
13514580 |
ttaggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtc |
13514526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 289 - 347
Target Start/End: Original strand, 25710503 - 25710561
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25710503 |
attattaggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
25710561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 28552019 - 28552133
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| ||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttgt |
28552118 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28552119 |
ttttggaaatagtcc |
28552133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 29490745 - 29490691
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29490745 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtct |
29490691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 31869959 - 31869905
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
31869959 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc |
31869905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 12741272 - 12741159
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | | |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattatttt |
12741173 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12741172 |
tttggaaatagtcc |
12741159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 293 - 346
Target Start/End: Complemental strand, 21159820 - 21159767
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
21159820 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
21159767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 28427243 - 28427296
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
28427243 |
taggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtc |
28427296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 29446208 - 29446155
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29446208 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
29446155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 37506865 - 37506918
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37506865 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37506918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 54608865 - 54608812
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
54608865 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54608812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 294 - 346
Target Start/End: Complemental strand, 474410 - 474358
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
474410 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
474358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 4513262 - 4513314
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
4513314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4513621 - 4513569
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtc |
4513569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 4950036 - 4950088
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
4950088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19844582 - 19844530
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
19844530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 20612899 - 20612847
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
20612847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 20757403 - 20757451
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
20757451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 21159452 - 21159504
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
21159504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 28427609 - 28427557
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28427557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 291 - 347
Target Start/End: Complemental strand, 28552388 - 28552332
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28552388 |
tattaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
28552332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 29525104 - 29525156
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtc |
29525156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 293 - 405
Target Start/End: Original strand, 30128281 - 30128393
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag-tcttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||| |||||||||||| || ||| ||||||||||||||||| || |||||||||| |
|
|
| T |
30128281 |
ttaggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt-aaaaaaattgttgtttttggtccctgctaaatattttgt |
30128379 |
T |
 |
| Q |
392 |
ttttggaaatagtc |
405 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
30128380 |
ttttgaaaatagtc |
30128393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 32119217 - 32119332
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| ||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
32119217 |
ttaggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
32119316 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32119317 |
tttttggaaatagtcc |
32119332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 32119585 - 32119533
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
32119533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 37507223 - 37507171
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37507171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 39437110 - 39437058
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
39437058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 293 - 403
Target Start/End: Complemental strand, 47005522 - 47005410
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
47005522 |
ttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatattttg |
47005423 |
T |
 |
| Q |
391 |
attttggaaatag |
403 |
Q |
| |
|
||||| |||||| |
|
|
| T |
47005422 |
tttttgaaaatag |
47005410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 50261936 - 50261884
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtct |
50261884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 51834607 - 51834659
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
51834659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 4034717 - 4034768
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
4034768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 8510214 - 8510265
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtc |
8510265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 10976978 - 10977029
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
10977029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 299 - 346
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 22156297 - 22156242
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22156297 |
attaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22156242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 25710870 - 25710819
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
25710819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 40169654 - 40169603
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
40169603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 1721086 - 1721140
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||| |||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
1721086 |
ttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtc |
1721140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 292 - 346
Target Start/End: Complemental strand, 7518450 - 7518396
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||| |||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
7518450 |
attagactaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 344
Target Start/End: Complemental strand, 9603921 - 9603871
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
9603921 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 20404958 - 20405004
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
20404958 |
ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc |
20405004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 20907459 - 20907405
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
20907459 |
taggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtct |
20907405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 30034173 - 30034219
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
30034173 |
ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc |
30034219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 39288901 - 39288847
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
39288901 |
ttaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
39288847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 40370285 - 40370335
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagt |
40370335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 43441270 - 43441320
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
43441320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 43441604 - 43441491
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
43441505 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43441504 |
tttggaaatagtcc |
43441491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 406
Target Start/End: Complemental strand, 45006247 - 45006137
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatttt |
395 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||||||| | | ||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttttt |
45006148 |
T |
 |
| Q |
396 |
ggaaatagtcc |
406 |
Q |
| |
|
||||||||||| |
|
|
| T |
45006147 |
ggaaatagtcc |
45006137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 46186410 - 46186460
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtc |
46186460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 51834945 - 51834891
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
51834945 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
51834891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 9262157 - 9262104
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
9262157 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
9262104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 20611019 - 20611072
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtct |
20611072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 293 - 346
Target Start/End: Complemental strand, 29955669 - 29955616
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29955669 |
ttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29955616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 293 - 346
Target Start/End: Complemental strand, 30004824 - 30004771
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
30004824 |
ttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30004771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 31480135 - 31480248
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | | |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattatttt |
31480234 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31480235 |
tttggaaatagtcc |
31480248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 406
Target Start/End: Complemental strand, 35569133 - 35569024
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgtttttg |
35569034 |
T |
 |
| Q |
397 |
gaaatagtcc |
406 |
Q |
| |
|
||||||||| |
|
|
| T |
35569033 |
aaaatagtcc |
35569024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 43440785 - 43440736
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtc |
43440736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 348
Target Start/End: Original strand, 45161116 - 45161165
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtct |
45161165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 365 - 406
Target Start/End: Complemental strand, 45313792 - 45313751
Alignment:
| Q |
365 |
gtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45313792 |
gtttttggtccctgcaaaatattttgattttggaaatagtcc |
45313751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 46186772 - 46186719
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtct |
46186719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 50196301 - 50196350
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
50196350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 51550080 - 51550133
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
51550133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 346
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4814899 - 4814848
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtc |
4814848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5345690 - 5345638
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
5345638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 7518089 - 7518201
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||| |||| |||||||| ||||| | |||||||||||||| ||||||| ||||| || |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaaaaaaaagttttgtttttggtccctgcaaaattttttgttt |
7518188 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
7518189 |
ttgaaaatagtcc |
7518201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 13584368 - 13584316
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
13584316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 14633890 - 14633838
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtc |
14633838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 25615974 - 25616026
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25616026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 26799887 - 26799939
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
26799939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 28942523 - 28942575
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
28942523 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 28942906 - 28942854
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
28942854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 30130505 - 30130453
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||| |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtc |
30130453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 30424628 - 30424680
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtct |
30424680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 30552479 - 30552427
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtc |
30552427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 40169343 - 40169395
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtc |
40169395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 43440494 - 43440546
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
43440546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 45002019 - 45002071
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45002019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
45002071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 46751270 - 46751322
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
46751322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 46901102 - 46901154
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| || ||||||||||||| |
|
|
| T |
46901102 |
taggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 47005153 - 47005205
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtc |
47005205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 49323782 - 49323894
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | || |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattattttt |
49323881 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49323882 |
ttggaaatagtcc |
49323894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 51500686 - 51500634
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtc |
51500634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 51759818 - 51759870
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| || |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtc |
51759870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 54608517 - 54608569
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
54608569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 3361817 - 3361766
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtct |
3361766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 7957226 - 7957175
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtc |
7957175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 8510533 - 8510478
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| | |||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
8510533 |
attaggcaacaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
8510478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 9863404 - 9863353
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtc |
9863353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 298 - 345
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 15016388 - 15016439
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
15016439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 16123139 - 16123190
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
16123190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 20644505 - 20644556
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtc |
20644556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 348
Target Start/End: Complemental strand, 20757778 - 20757723
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| || ||||||||||||||| |
|
|
| T |
20757778 |
ttaggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtct |
20757723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 22008890 - 22008839
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
22008839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 406
Target Start/End: Original strand, 25609763 - 25609878
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||||| |||| ||| | |||||| | ||| |||||||||||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
25609763 |
attaggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg |
25609862 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
25609863 |
tttttgaaaatagtcc |
25609878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 40370589 - 40370538
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
40370538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 344
Target Start/End: Original strand, 52342192 - 52342243
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
52342192 |
ttaggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 275833 - 275783
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 15286155 - 15286209
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtctt |
15286209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 28452303 - 28452269
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggtttt |
28452269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 285 - 347
Target Start/End: Complemental strand, 34238926 - 34238864
Alignment:
| Q |
285 |
attaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||| ||||||||| || |||||||||||||| |
|
|
| T |
34238926 |
attaattaaaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtc |
34238864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 39132909 - 39132855
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||| ||||||| |||| |
|
|
| T |
39132909 |
ttaggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtc |
39132855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 40545561 - 40545615
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
40545561 |
ttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtc |
40545615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 44802282 - 44802332
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagt |
44802332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 275442 - 275495
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||| ||||| |||||||| |
|
|
| T |
275442 |
taggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtc |
275495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 9603627 - 9603680
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
9603627 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
9603680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 29955300 - 29955349
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
29955349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 30004454 - 30004503
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
30004503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 30034474 - 30034421
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
30034474 |
taggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtc |
30034421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 30106222 - 30106169
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
30106222 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtc |
30106169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 31869596 - 31869645
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtc |
31869645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 398
Target Start/End: Complemental strand, 35407792 - 35407687
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| |||| |||||||| | ||| |||||||||||| |||| ||||||||||||| | |
|
|
| T |
35407792 |
taggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaaaaaaatttgttgtttttgatccctgcaaaatattttgtt |
35407693 |
T |
 |
| Q |
393 |
tttgga |
398 |
Q |
| |
|
|||||| |
|
|
| T |
35407692 |
tttgga |
35407687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 346
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 40979711 - 40979662
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta |
40979662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 340
Target Start/End: Complemental strand, 44802549 - 44802504
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggt |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 45002386 - 45002273
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | | |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattatttt |
45002287 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45002286 |
tttggaaatagtcc |
45002273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 46622131 - 46622078
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| || |||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtc |
46622078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 48924246 - 48924189
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
48924246 |
ttataaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
48924189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 49324148 - 49324095
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| |||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
49324148 |
taggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
49324095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 50196659 - 50196606
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||| |||| ||||||||| |
|
|
| T |
50196659 |
taggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtc |
50196606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 406
Target Start/End: Original strand, 52956450 - 52956495
Alignment:
| Q |
361 |
tgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
52956450 |
tgttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
52956495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 1721453 - 1721401
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
1721401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 3387268 - 3387316
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
3387316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 3387605 - 3387553
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtc |
3387553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 8940522 - 8940474
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
8940474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 10977342 - 10977290
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtc |
10977290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 12673643 - 12673695
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
12673643 |
aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtc |
12673695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 14772210 - 14772262
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
14772262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 332
Target Start/End: Original strand, 18175791 - 18175827
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctc |
332 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctc |
18175827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 19656540 - 19656592
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtc |
19656592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 47336227 - 47336279
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
47336279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 345
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||| || ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 52342584 - 52342532
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtc |
52342532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 343
Target Start/End: Original strand, 53113442 - 53113490
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 3151818 - 3151861
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
3151818 |
ttgtttttggtccctgcaaaattttttgtttttggaaatagtcc |
3151861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 293 - 344
Target Start/End: Original strand, 4321943 - 4321994
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| || | ||| |||||||||||||||||||||||||| |
|
|
| T |
4321943 |
ttaggctaaaatatggttctgatccttgcaaatatgtctcattttggtttta |
4321994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Complemental strand, 10977272 - 10977229
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
10977272 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
10977229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 14772529 - 14772474
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| |||||||||| ||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
14772529 |
attagactaaaatatggttttagtacatgcaaatatacctcattttggttttagtc |
14772474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 15979338 - 15979389
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
15979389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 26089730 - 26089781
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
26089781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 299 - 346
Target Start/End: Original strand, 27200441 - 27200488
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||| ||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
27200441 |
taaaatatggttttaatccctgcaaatatatctcattttagttttagt |
27200488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 31480500 - 31480449
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtc |
31480449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 309 - 348
Target Start/End: Original strand, 35565581 - 35565620
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtct |
35565620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 299 - 346
Target Start/End: Original strand, 36732643 - 36732690
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||| | |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
36732643 |
taaaataaggttttggtccctgcaaatatgtcttattttggttttagt |
36732690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 39436786 - 39436829
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
39436786 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
39436829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 474335 - 474301
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
474335 |
ttttggtccctgcaaatatgtctcattttggtttt |
474301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 863579 - 863545
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
863579 |
ttttggtccctgcaaatatgtctcattttggtttt |
863545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 4035053 - 4035003
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||| |||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagt |
4035003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 4322123 - 4322077
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| || ||||||||||||| ||||| ||||||||| |
|
|
| T |
4322123 |
ttgttgtttttggttcctgcaaaatattttgtttttgaaaatagtcc |
4322077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 7588316 - 7588370
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtct |
7588370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 11463233 - 11463283
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| || |||||||||||| ||| |||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtc |
11463283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 12740980 - 12741014
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
12740980 |
ttttggtccctgcaaatatgtctcattttggtttt |
12741014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 15979411 - 15979445
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
15979411 |
ttttggtccctgcaaatatgtctcattttggtttt |
15979445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 19297883 - 19297837
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
19297883 |
ttgttgtttttggtccctgcaaaatattttacttttgaaaatagtcc |
19297837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 21553888 - 21553938
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||| ||||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
21553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 22008817 - 22008783
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
22008817 |
ttttggtccctgcaaatatgtctcattttggtttt |
22008783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 22016335 - 22016301
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
22016335 |
ttttggtccctgcaaatatgtctcattttggtttt |
22016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 25610129 - 25610079
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
25610079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 27681616 - 27681570
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
27681616 |
ttgttgtttttgatccctgcaaaatattttgtttttgaaaatagtcc |
27681570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 28452379 - 28452325
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||| || |||||||||||||| |
|
|
| T |
28452379 |
ttaggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtc |
28452325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 28552310 - 28552276
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28552310 |
ttttggtccctgcaaatatgtctcattttggtttt |
28552276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 31480427 - 31480393
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
31480427 |
ttttggtccctgcaaatatgtctcattttggtttt |
31480393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 32119511 - 32119477
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
32119511 |
ttttggtccctgcaaatatgtctcattttggtttt |
32119477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 36672961 - 36673015
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36672961 |
taggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtct |
36673015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 47336301 - 47336335
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
47336301 |
ttttggtccctgcaaatatgtctcattttggtttt |
47336335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 49324073 - 49324039
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
49324073 |
ttttggtccctgcaaatatgtctcattttggtttt |
49324039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 50008921 - 50008971
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||| |||| |||||||||||||||| | ||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtc |
50008971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 51500396 - 51500450
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||| ||| ||||||||||||||| |
|
|
| T |
51500396 |
taggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtct |
51500450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 51550155 - 51550189
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
51550155 |
ttttggtccctgcaaatatgtctcattttggtttt |
51550189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 53113697 - 53113651
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
53113697 |
ttgttgtttttggtccctgcaaaatattttacttttgaaaatagtcc |
53113651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 54608591 - 54608625
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
54608591 |
ttttggtccctgcaaatatgtctcattttggtttt |
54608625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 9863045 - 9863097
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
9863045 |
taggttaaaatatggttttagtccctgc-aatatgcctcgttttggttttagtc |
9863097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 328
Target Start/End: Complemental strand, 26800170 - 26800137
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
26800170 |
aggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 29678387 - 29678338
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag |
29678338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 347
Target Start/End: Original strand, 30552141 - 30552197
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| ||||||||| |||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
30552141 |
ttattaggttaaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtc |
30552197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 344
Target Start/End: Original strand, 49670477 - 49670522
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggtttta |
49670522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 863649 - 863601
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| |||||||||||||||| || ||||| |||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtc |
863601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 4322186 - 4322138
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtc |
4322138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 315 - 343
Target Start/End: Complemental strand, 8940446 - 8940418
Alignment:
| Q |
315 |
tccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8940446 |
tccctgcaaatatgtctcattttggtttt |
8940418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 9597096 - 9597044
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtc |
9597044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 20807800 - 20807848
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtc |
20807848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 29686543 - 29686595
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| |||||| |||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtc |
29686595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35565507 - 35565559
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtc |
35565559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||| ||||| ||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta |
39072165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Complemental strand, 40477434 - 40477402
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
40477434 |
aggctaaaatatgattttggtccctgcaaatat |
40477402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Original strand, 44506581 - 44506613
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44506581 |
aggctaaaatatggttttagtccctgcaaatat |
44506613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Complemental strand, 44507859 - 44507827
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
44507859 |
aggctaaaatatgattttggtccctgcaaatat |
44507827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 45005889 - 45005937
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtc |
45005937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 291 - 327
Target Start/End: Complemental strand, 47433873 - 47433837
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
47433873 |
tattaggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 49670803 - 49670751
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccc-tgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtc |
49670751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 327
Target Start/End: Complemental strand, 53122531 - 53122499
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
53122531 |
aggctaaaatatgcttttagtccctgcaaatat |
53122499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 7e-22; HSPs: 192)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 291 - 348
Target Start/End: Complemental strand, 30709649 - 30709592
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30709649 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtct |
30709592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 25988382 - 25988497
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
25988382 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
25988481 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25988482 |
tttttggaaatagtcc |
25988497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 348
Target Start/End: Original strand, 31310362 - 31310417
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
31310362 |
ttaggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtct |
31310417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 8144294 - 8144407
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttgtt |
8144393 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8144394 |
tttggaaatagtcc |
8144407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 17854146 - 17854200
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17854146 |
ttagactaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
17854200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 39832903 - 39832957
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39832903 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39832957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 1614905 - 1614792
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
1614806 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1614805 |
tttggaaatagtcc |
1614792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 5234205 - 5234092
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||| |||||||||||||| ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt |
5234106 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5234105 |
tttggaaatagtcc |
5234092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 9659690 - 9659577
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
9659591 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9659590 |
tttggaaatagtcc |
9659577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 18022706 - 18022653
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18022706 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
18022653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 291 - 348
Target Start/End: Original strand, 23816665 - 23816722
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
23816665 |
tattaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtct |
23816722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 14543709 - 14543761
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
14543761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 291 - 347
Target Start/End: Complemental strand, 19561455 - 19561399
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19561455 |
tattcggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19561399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 44344790 - 44344738
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
44344738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 294 - 346
Target Start/End: Complemental strand, 45021858 - 45021806
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45021858 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 13769774 - 13769825
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13769825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 35210515 - 35210464
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
35210464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 288 - 347
Target Start/End: Original strand, 46759650 - 46759709
Alignment:
| Q |
288 |
aattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
46759650 |
aatttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
46759709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 46759942 - 46759891
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
46759891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 23399977 - 23399864
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| |||||||||||| | |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttttt |
23399878 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23399877 |
tttggaaatagtcc |
23399864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 405
Target Start/End: Complemental strand, 29198664 - 29198551
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgt |
29198565 |
T |
 |
| Q |
392 |
ttttggaaatagtc |
405 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29198564 |
ttttggaaatagtc |
29198551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 35838340 - 35838286
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35838340 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35838286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 41054239 - 41054185
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
41054239 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
41054185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 1614557 - 1614610
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
1614557 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
1614610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 7431951 - 7432004
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctt |
7432004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 10357999 - 10358052
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10357999 |
taggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtc |
10358052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 12932785 - 12932672
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||| ||||||| | ||| ||||||||||||||||| ||||||||||| | | |
|
|
| T |
12932785 |
taggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaatttgttgtttttggtccctgcaaaatatttggtt |
12932686 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
12932685 |
tttgaaaatagtcc |
12932672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 17999723 - 17999670
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
17999723 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
17999670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 19783813 - 19783866
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19783813 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
19783866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 30223796 - 30223683
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc-ttgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| ||| |||||||||||||| |||| || ||||||||||||||| |||||||||||| | |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatattttatt |
30223697 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30223696 |
tttggaaatagtcc |
30223683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 41053841 - 41053954
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||| ||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
41053940 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
41053941 |
tttgaaaatagtcc |
41053954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 45228919 - 45228806
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| | ||||||||||| | |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgtaaaatattttgtt |
45228820 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45228819 |
tttggaaatagtcc |
45228806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 489073 - 489021
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtc |
489021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 6108333 - 6108385
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
6108385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 12894403 - 12894351
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
12894351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 14738603 - 14738651
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtc |
14738651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 19757747 - 19757799
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
19757799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 21223405 - 21223457
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtct |
21223457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 25092159 - 25092211
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
25092211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 27458398 - 27458450
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
27458450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 28911907 - 28911855
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
28911855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35104077 - 35104129
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtc |
35104129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 406
Target Start/End: Original strand, 35469880 - 35469992
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || ||||||||||||||| ||| || ||||||||||||||| ||||||||||||| || |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaaatattttgttt |
35469979 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
35469980 |
ttgaaaatagtcc |
35469992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 35837923 - 35837975
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
35837975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 39719353 - 39719405
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtct |
39719405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 291 - 347
Target Start/End: Complemental strand, 39719647 - 39719591
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
39719647 |
tattaggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtc |
39719591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 44402959 - 44403011
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtc |
44403011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 44509055 - 44509003
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44509003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 44958507 - 44958455
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtc |
44958455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 46304085 - 46304137
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtc |
46304137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 1006835 - 1006886
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1006886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 1974009 - 1974060
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
1974060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 21554393 - 21554444
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtc |
21554444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 25547490 - 25547439
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
25547439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 300 - 347
Target Start/End: Original strand, 37372441 - 37372488
Alignment:
| Q |
300 |
aaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
37372488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 37372905 - 37372854
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37372854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 292 - 351
Target Start/End: Original strand, 39438737 - 39438796
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcttgt |
351 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
39438737 |
attaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtcttgt |
39438796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 44403249 - 44403198
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
44403198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 44508720 - 44508771
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44508771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 46829312 - 46829261
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtc |
46829261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 48192490 - 48192376
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| || ||||||||| ||||||| ||||||||||||| |
|
|
| T |
48192490 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaaatattttgt |
48192391 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48192390 |
ttttggaaatagtcc |
48192376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 3975841 - 3975787
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3975841 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3975787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 11767278 - 11767224
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
11767278 |
ttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtc |
11767224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 20388271 - 20388325
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
20388271 |
ttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
20388325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 23399609 - 23399663
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23399609 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
23399663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 23676129 - 23676183
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
23676129 |
ttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
23676183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 27037659 - 27037705
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
27037659 |
ttgttgtttttggtccctgcaaaatattttgtttttggaaatagtcc |
27037705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 28262711 - 28262825
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||| || ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
28262711 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaaatattttac |
28262810 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
28262811 |
ttttgaaaatagtcc |
28262825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 38186762 - 38186708
Alignment:
| Q |
295 |
aggctaaaatatgattttag-tccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtct |
38186708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 43300613 - 43300663
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtc |
43300663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 44568691 - 44568578
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttgtt |
44568592 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
44568591 |
ttttgaaatagtcc |
44568578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 8144660 - 8144607
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
8144607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 8555800 - 8555751
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 23676454 - 23676401
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23676454 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
23676401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 26878073 - 26878020
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26878073 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
26878020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 28911575 - 28911628
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
28911575 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtc |
28911628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 29198301 - 29198354
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
29198301 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
29198354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 31503780 - 31503731
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtct |
31503731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 32189076 - 32189129
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtctt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttaatctt |
32189129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 35015222 - 35015169
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
35015222 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
35015169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 37952671 - 37952720
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtc |
37952720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 293 - 346
Target Start/End: Original strand, 38486475 - 38486528
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| |||| |||||||| |
|
|
| T |
38486475 |
ttaggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 3975548 - 3975600
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3975600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 6509207 - 6509259
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtc |
6509259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 6509471 - 6509419
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
6509419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 16941049 - 16941001
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
16941001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 21223749 - 21223697
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
21223697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 25092549 - 25092497
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtc |
25092497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 25988750 - 25988698
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25988698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 30223460 - 30223512
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtc |
30223512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 30709328 - 30709376
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtc |
30709376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 39439030 - 39438978
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
39438978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 45073642 - 45073590
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
45073590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 46828943 - 46828995
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc |
46828995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 48854071 - 48854019
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtc |
48854019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 5308323 - 5308374
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
5308374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 10358368 - 10358317
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
10358317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 13770082 - 13770031
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagt |
13770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 16853589 - 16853538
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
16853538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 17999465 - 17999512
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 32189394 - 32189339
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
32189394 |
attagactaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtc |
32189339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 39833236 - 39833185
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
39833185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 344
Target Start/End: Original strand, 45073311 - 45073362
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
45073311 |
ttaggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta |
45073362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 46304384 - 46304333
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtc |
46304333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 5354765 - 5354819
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
5354765 |
ttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
5354819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 6079810 - 6079860
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
6079860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 35104298 - 35104244
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35104298 |
ttaggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
35104244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 35210179 - 35210233
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
| T |
35210179 |
ttaggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtc |
35210233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 35470283 - 35470229
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
35470283 |
ttaggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtc |
35470229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 35665874 - 35665928
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
35665874 |
ttaggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtc |
35665928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 9659353 - 9659406
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
9659353 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtc |
9659406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 18891562 - 18891513
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtct |
18891513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 19465982 - 19465930
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| ||| |||||||||| |
|
|
| T |
19465982 |
taggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtc |
19465930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 21554755 - 21554702
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
21554755 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtc |
21554702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 360 - 405
Target Start/End: Complemental strand, 27458653 - 27458608
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
27458653 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtc |
27458608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 360 - 405
Target Start/End: Original strand, 31503486 - 31503531
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
31503486 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtc |
31503531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 279 - 344
Target Start/End: Original strand, 31732085 - 31732149
Alignment:
| Q |
279 |
ttaacaattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||| |||| |||||| |||||||||||| |||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
31732085 |
ttaataatttattatt-ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 37953048 - 37952999
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtct |
37952999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 1559706 - 1559654
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtc |
1559654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 2945846 - 2945794
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtc |
2945794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 3807862 - 3807914
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagt |
3807914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 5233807 - 5233859
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
5233859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5308687 - 5308636
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtc |
5308636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Original strand, 6954862 - 6954910
Alignment:
| Q |
300 |
aaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtct |
6954910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 14739005 - 14738953
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtc |
14738953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 347
Target Start/End: Complemental strand, 19758044 - 19758008
Alignment:
| Q |
311 |
ttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtc |
19758008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 22539928 - 22539980
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagt |
22539980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 25547251 - 25547303
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
25547251 |
taggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 26877677 - 26877729
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtc |
26877729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 30352563 - 30352611
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||||| |||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtc |
30352611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 34877777 - 34877825
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
34877825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 39520397 - 39520449
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||||||| |||||||||||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtc |
39520449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 44568325 - 44568377
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtc |
44568377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 45021494 - 45021546
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcatttt-ggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtc |
45021546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 45671212 - 45671264
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||| ||||||||| ||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
45671212 |
taggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagt |
45671264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 48192260 - 48192308
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
48192308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 48852443 - 48852495
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc |
48852495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 1007229 - 1007178
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||| ||||| |||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtc |
1007178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 309 - 348
Target Start/End: Complemental strand, 3808106 - 3808067
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtct |
3808067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 23817035 - 23816984
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||| ||||||| ||||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagt |
23816984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 24717532 - 24717481
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||| | |||||||||| |||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtc |
24717481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 367 - 406
Target Start/End: Complemental strand, 25092451 - 25092412
Alignment:
| Q |
367 |
ttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
25092451 |
ttttggtccctgcaaaatattttgtttttggaaatagtcc |
25092412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 27037593 - 27037644
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtc |
27037644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 30352904 - 30352853
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtc |
30352853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 342
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttt |
342 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 292 - 327
Target Start/End: Complemental strand, 31848207 - 31848172
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31848207 |
attaggctaaaatatgtttttagtccctgcaaatat |
31848172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 330
Target Start/End: Complemental strand, 36687264 - 36687229
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtc |
330 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36687264 |
aggctaaaatatgattttggtccctgcaaatatgtc |
36687229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 41364884 - 41364935
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||| || || |||||||||||| |||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtc |
41364935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 1614632 - 1614666
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
1614632 |
ttttggtccctgcaaatatgtctcattttggtttt |
1614666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 327
Target Start/End: Complemental strand, 5611569 - 5611535
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
5611569 |
ttaggctaaaatatgattttggtccctgcaaatat |
5611535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 6847117 - 6847067
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtct |
6847067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 8144585 - 8144551
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
8144585 |
ttttggtccctgcaaatatgtctcattttggtttt |
8144551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 20355405 - 20355459
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||| |||||||| ||||| |
|
|
| T |
20355405 |
ttaggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtc |
20355459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 23399685 - 23399719
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
23399685 |
ttttggtccctgcaaatatgtctcattttggtttt |
23399719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 23676205 - 23676239
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
23676205 |
ttttggtccctgcaaatatgtctcattttggtttt |
23676239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 25092233 - 25092267
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
25092233 |
ttttggtccctgcaaatatgtctcattttggtttt |
25092267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 25988676 - 25988642
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
25988676 |
ttttggtccctgcaaatatgtctcattttggtttt |
25988642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 26877751 - 26877785
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
26877751 |
ttttggtccctgcaaatatgtctcattttggtttt |
26877785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 27037860 - 27037826
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
27037860 |
ttttggtccctgcaaatatgtctcattttggtttt |
27037826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 29198376 - 29198410
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29198376 |
ttttggtccctgcaaatatgtctcattttggtttt |
29198410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| ||||| |||||| |
|
|
| T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 37527421 - 37527371
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtc |
37527371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 347
Target Start/End: Complemental strand, 41054163 - 41054125
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
41054125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 44568399 - 44568433
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44568399 |
ttttggtccctgcaaatatgtctcattttggtttt |
44568433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 1559342 - 1559391
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 5355119 - 5355066
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||| |||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5355119 |
taggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 6892262 - 6892209
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||| |||||| ||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtc |
6892209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 363 - 404
Target Start/End: Original strand, 6911152 - 6911193
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagt |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
6911152 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagt |
6911193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 18311946 - 18311889
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| |||||||||||||||| ||||| ||||||| ||| ||||| |||||||| |
|
|
| T |
18311946 |
ttattagactaaaatatgattttaatccctctaaatatgcctcgttttgattttagtc |
18311889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 346
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| ||||||| || ||||||||| ||| ||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 43058752 - 43058801
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtc |
43058801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 44344456 - 44344505
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||||| ||| ||||||| |
|
|
| T |
44344456 |
aggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 45671550 - 45671497
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
45671550 |
taggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtc |
45671497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 360 - 401
Target Start/End: Complemental strand, 48854004 - 48853963
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaat |
401 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
48854004 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaat |
48853963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 342
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
302 |
aatatgattttagtccctgcaaatatgtctcattttggttt |
342 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 396
Target Start/End: Original strand, 5354834 - 5354870
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
5354834 |
ttgttgtttttggtccctgcaaaatattttgtttttg |
5354870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 6589271 - 6589223
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtc |
6589223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 404
Target Start/End: Original strand, 6846851 - 6846895
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagt |
404 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||||| ||||||| |
|
|
| T |
6846851 |
ttgttgtttttggtccctgtaaaatattttgtttttgaaaatagt |
6846895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 6911081 - 6911133
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||||| ||||| |||||||| |
|
|
| T |
6911081 |
aggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtc |
6911133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 343
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 16940761 - 16940813
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtc |
16940813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 343
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||| |||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 291 - 327
Target Start/End: Complemental strand, 32197973 - 32197937
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
32197973 |
tattaggctaaaatatgcttttggtccctgcaaatat |
32197937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 396
Target Start/End: Complemental strand, 39520664 - 39520628
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
39520664 |
ttgttgtttttggtccctgcaaaatattttgtttttg |
39520628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 39520727 - 39520679
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||| ||||| |||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtc |
39520679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 186)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 294 - 402
Target Start/End: Complemental strand, 11788418 - 11788309
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
11788418 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaattttttttgttgtttttggtccctgcaaaatattttgct |
11788319 |
T |
 |
| Q |
393 |
tttggaaata |
402 |
Q |
| |
|
|||| ||||| |
|
|
| T |
11788318 |
tttgaaaata |
11788309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 289 - 406
Target Start/End: Complemental strand, 16523332 - 16523213
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatat |
386 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
16523332 |
attaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatat |
16523233 |
T |
 |
| Q |
387 |
tttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
16523232 |
tttgattttgaaaatagtcc |
16523213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 7814740 - 7814686
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7814740 |
ttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtc |
7814686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 25705084 - 25705197
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgtt |
25705183 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25705184 |
tttggaaatagtcc |
25705197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 286 - 347
Target Start/End: Complemental strand, 45442706 - 45442645
Alignment:
| Q |
286 |
ttaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45442706 |
ttaattataaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc |
45442645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 12835325 - 12835376
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtc |
12835376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 348
Target Start/End: Original strand, 17912446 - 17912501
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17912446 |
ttaggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtct |
17912501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 348
Target Start/End: Original strand, 38639409 - 38639464
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38639409 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtct |
38639464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 23989835 - 23989889
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23989835 |
ttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 10671943 - 10671890
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10671943 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
10671890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 287 - 406
Target Start/End: Original strand, 13215051 - 13215172
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaat |
384 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||| |
|
|
| T |
13215051 |
taattactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaat |
13215150 |
T |
 |
| Q |
385 |
attttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||| |||| ||||||||| |
|
|
| T |
13215151 |
attttgttttttaaaatagtcc |
13215172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 294 - 351
Target Start/End: Original strand, 26709694 - 26709751
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcttgt |
351 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtcttgt |
26709751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 29859873 - 29859760
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| ||| || ||||||||||||||| ||||||||||||| | |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaaatattttgtt |
29859774 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29859773 |
tttggaaatagtcc |
29859760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 40125290 - 40125177
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||| | ||| ||||||||||||||||| ||||||||||||| | |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttgtt |
40125191 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
40125190 |
tttgaaaatagtcc |
40125177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 146690 - 146578
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| || |||||||||||||| ||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttgttt |
146591 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
146590 |
ttggaaatagtcc |
146578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 2265398 - 2265346
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc |
2265346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 3172019 - 3172071
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtc |
3172071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 16673410 - 16673462
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
16673462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 19183781 - 19183833
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19183833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 24358613 - 24358728
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
24358613 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttg |
24358712 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24358713 |
tttttggaaatagtcc |
24358728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 33575749 - 33575864
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
33575749 |
ttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
33575848 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33575849 |
tttttggaaatagtcc |
33575864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 43592381 - 43592329
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
43592381 |
aggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtc |
43592329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 43597500 - 43597448
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc |
43597448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 5790899 - 5790848
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
5790848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 11713485 - 11713536
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
11713536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 26813866 - 26813917
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26813917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 36622250 - 36622301
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
36622301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 41694003 - 41693952
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
41693952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 9195054 - 9195104
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
9195104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 14003743 - 14003630
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttgtt |
14003644 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14003643 |
tttggaaatagtcc |
14003630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 15842824 - 15842711
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| | |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
15842725 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15842724 |
tttggaaatagtcc |
15842711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 20131314 - 20131368
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
20131314 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20131368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 292 - 389
Target Start/End: Complemental strand, 29182446 - 29182348
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatatttt |
389 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29182446 |
attagactaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaattgttgtttttggtccctgcaaaatatttt |
29182348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 29865222 - 29865272
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
29865272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 292 - 405
Target Start/End: Original strand, 37910752 - 37910866
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||| |||||||| ||||||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
37910752 |
attaggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaaatattttg |
37910851 |
T |
 |
| Q |
391 |
attttggaaatagtc |
405 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
37910852 |
tttttgaaaatagtc |
37910866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 44985987 - 44985933
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
44985987 |
ttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
44985933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 20131681 - 20131569
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| || |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgttt |
20131582 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||| |
|
|
| T |
20131581 |
ttggaaatagtcc |
20131569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 26239162 - 26239109
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
26239109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 29182167 - 29182220
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29182167 |
aggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtct |
29182220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 31644840 - 31644893
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtct |
31644893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 40302341 - 40302288
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40302341 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
40302288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 41451835 - 41451888
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
41451835 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
41451888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 290 - 347
Target Start/End: Original strand, 43592040 - 43592097
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
43592040 |
ttattaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
43592097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 43788856 - 43788909
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
43788856 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
43788909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 44559060 - 44559113
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
44559060 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4424186 - 4424134
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
4424134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 16900207 - 16900155
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16900155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 16993598 - 16993546
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
16993546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 17541777 - 17541725
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
17541725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19184152 - 19184100
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
19184100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 22881612 - 22881664
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
22881664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 24483892 - 24483840
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
24483840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 25954114 - 25954166
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtc |
25954166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 26814230 - 26814178
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
26814178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 30215873 - 30215758
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn--ttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| || | |||||||||||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
30215873 |
taggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
30215774 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30215773 |
tttttggaaatagtcc |
30215758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 33576118 - 33576066
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
33576066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 33732861 - 33732913
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
33732913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 37271738 - 37271790
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37271790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 37272103 - 37272051
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
37272051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 38980254 - 38980202
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
38980202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 40301974 - 40302026
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
40302026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 41693673 - 41693725
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
41693725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 293 - 406
Target Start/End: Complemental strand, 1138362 - 1138247
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnn-ttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||| ||||||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
1138362 |
ttaggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaaatattttg |
1138263 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
1138262 |
tttttgaaaatagtcc |
1138247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 404
Target Start/End: Original strand, 1295181 - 1295292
Alignment:
| Q |
295 |
aggctaaa-atatgattttagtccctgcaaatatgtctcattttggttttagtc-ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||| |||||||||| |||| || ||||||||||| |||||||||||||| |||| ||||||||||||||||| ||||||||| ||| | |
|
|
| T |
1295181 |
aggctaaatatatgattttggtccatgtaaatatgtctcgttttggttttagtctttgtatatttttttgttgtttttggtccctgcaaaatatattgtt |
1295280 |
T |
 |
| Q |
393 |
tttggaaatagt |
404 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
1295281 |
tttgaaaatagt |
1295292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 290 - 388
Target Start/End: Complemental strand, 4794478 - 4794380
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnnttgttgtttttggtccccgcaaaatattt |
388 |
Q |
| |
|
||||||||||||| |||| |||| |||||| |||||||||||| ||||||||||||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
4794478 |
ttattaggctaaa-tatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaaaaaaaattgttgtttttggtccctgcaaaatattt |
4794380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 23732039 - 23732090
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtc |
23732090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 34317798 - 34317849
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
34317849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 284 - 347
Target Start/End: Original strand, 40786448 - 40786511
Alignment:
| Q |
284 |
aattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| || ||||||||||||||| ||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
40786448 |
aattattttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtc |
40786511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 42695868 - 42695919
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
42695919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 397
Target Start/End: Complemental strand, 7121308 - 7121207
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc-ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgattt |
394 |
Q |
| |
|
|||||||||||| ||||||||| || |||||||| ||||||| ||||||||| |||| ||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
7121308 |
ggctaaaatatggttttagtcc-tgtaaatatgtttcattttagttttagtccttgtaaaaaaaattgttgtttttggtccctgcaaaatattttgtttt |
7121210 |
T |
 |
| Q |
395 |
tgg |
397 |
Q |
| |
|
||| |
|
|
| T |
7121209 |
tgg |
7121207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 10664981 - 10665035
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
10664981 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtc |
10665035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 20939324 - 20939274
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20939274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 25705452 - 25705398
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25705452 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25705398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 40124966 - 40125016
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
40125016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 43597151 - 43597205
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
43597151 |
ttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
43597205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 44559407 - 44559357
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtct |
44559357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 44985618 - 44985672
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44985618 |
ttagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
44985672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 9195208 - 9195155
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtc |
9195155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 10374775 - 10374824
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10374824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 10671628 - 10671681
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
10671681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 27311071 - 27311018
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtc |
27311018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 35155298 - 35155343
Alignment:
| Q |
302 |
aatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
35155343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 37228732 - 37228785
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtct |
37228785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 41791020 - 41791069
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtc |
41791069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 43672319 - 43672206
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||||||||||||| | ||| || |||||||||||||| ||||||||||||| | |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaaatattttgtt |
43672220 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
43672219 |
tttgaaaatagtcc |
43672206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 44994062 - 44994009
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
44994062 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtct |
44994009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 291 - 347
Target Start/End: Original strand, 146321 - 146377
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||| |||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
146321 |
tattagactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
146377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 2481558 - 2481506
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
2481506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 3172533 - 3172481
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtc |
3172481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 3837932 - 3837984
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtc |
3837984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 4423894 - 4423946
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
4423946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 8046328 - 8046380
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
8046380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 11713846 - 11713794
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtc |
11713794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 14393129 - 14393078
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
14393129 |
aggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagtc |
14393078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 291 - 347
Target Start/End: Original strand, 15842456 - 15842512
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15842456 |
tattaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
15842512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 16522990 - 16523042
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
16523042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 17302144 - 17302092
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| |||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtc |
17302092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 17541381 - 17541433
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtc |
17541433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 26238816 - 26238864
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
26238864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 32476094 - 32476146
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtc |
32476146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 38731828 - 38731880
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
38731880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 42358702 - 42358750
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
42358750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 43710384 - 43710432
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtc |
43710432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 43710709 - 43710657
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||| |||||||||||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtc |
43710657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 44073808 - 44073756
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
44073756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 347
Target Start/End: Original strand, 3670999 - 3671054
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
3670999 |
attaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtc |
3671054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 3671192 - 3671141
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3671141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 309 - 348
Target Start/End: Original strand, 3832344 - 3832383
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3832344 |
ttttagtccctgcaaatatgtctcattttggttttggtct |
3832383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 4042890 - 4042839
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtc |
4042839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 4794130 - 4794181
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
4794181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 5334751 - 5334802
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5334802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 5335040 - 5334989
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5334989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 5790558 - 5790609
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtc |
5790609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 8046648 - 8046597
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
8046597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 13215369 - 13215318
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
13215369 |
attaggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 16673775 - 16673720
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
16673775 |
attaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtc |
16673720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 20658413 - 20658362
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
20658413 |
attaggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 342
Target Start/End: Original strand, 27310875 - 27310922
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttt |
342 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 347
Target Start/End: Complemental strand, 36806892 - 36806845
Alignment:
| Q |
300 |
aaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
36806845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 346
Target Start/End: Complemental strand, 36815836 - 36815785
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagt |
36815785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 289 - 344
Target Start/End: Complemental strand, 38732140 - 38732085
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
38732140 |
attattaggttaaaatttgattttagtcccagcaaatatggctcgttttggtttta |
38732085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 3832639 - 3832585
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
3832639 |
taggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtct |
3832585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 3838263 - 3838213
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
3838213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 14003406 - 14003460
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
14003406 |
ttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
14003460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 31909480 - 31909427
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtct |
31909427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 33576073 - 33576039
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576073 |
ttttagtccctgcaaatatgtctcattttggtttt |
33576039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 17912808 - 17912759
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtct |
17912759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 347
Target Start/End: Original strand, 18113083 - 18113140
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
18113083 |
ttataaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtc |
18113140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 20658059 - 20658112
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtc |
20658112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 29865513 - 29865460
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
29865513 |
taggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc |
29865460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||| ||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 2481192 - 2481244
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| || | |||||||||||||| |||||||||||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtc |
2481244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 4042609 - 4042661
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
4042661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 7814245 - 7814297
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtc |
7814297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 24358946 - 24358894
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtc |
24358894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 29859490 - 29859538
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
29859538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 30215421 - 30215473
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
30215473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 38979889 - 38979941
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatat-gtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtc |
38979941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 41791312 - 41791260
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtct |
41791260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 43789193 - 43789141
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtc |
43789141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 1497610 - 1497661
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtc |
1497661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 299 - 342
Target Start/End: Complemental strand, 1696452 - 1696409
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttt |
342 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
1696452 |
taaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 27109073 - 27109124
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtc |
27109124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 31225714 - 31225765
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
31225765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 40302044 - 40302087
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
40302044 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
40302087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 406
Target Start/End: Complemental strand, 42696202 - 42696091
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgtnnnnnnnntt-gttgtttttggtccccgcaaaatattttgattt |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||| |||||||||||||| ||| || |||||||||| |||| ||||||||||||| ||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaatttgttgtttttgatccctgcaaaatattttgtttt |
42696103 |
T |
 |
| Q |
395 |
tggaaatagtcc |
406 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
42696102 |
tgaaaatagtcc |
42696091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 146399 - 146433
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
146399 |
ttttggtccctgcaaatatgtctcattttggtttt |
146433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 2481266 - 2481300
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2481266 |
ttttggtccctgcaaatatgtctcattttggtttt |
2481300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 3172465 - 3172419
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| | ||||||||||||| ||||| ||||||||| |
|
|
| T |
3172465 |
ttgttgtttttggtctctgcaaaatattttgtttttgaaaatagtcc |
3172419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 4842865 - 4842915
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtc |
4842915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 5334967 - 5334933
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
5334967 |
ttttggtccctgcaaatatgtctcattttggtttt |
5334933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 405
Target Start/End: Complemental strand, 7814671 - 7814629
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
7814671 |
ttgtttttggtccccgcaaaattttttgtttttgaaaatagtc |
7814629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 15842534 - 15842568
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
15842534 |
ttttggtccctgcaaatatgtctcattttggtttt |
15842568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 16673484 - 16673518
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
16673484 |
ttttggtccctgcaaatatgtctcattttggtttt |
16673518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 20131390 - 20131424
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
20131390 |
ttttggtccctgcaaatatgtctcattttggtttt |
20131424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 23732256 - 23732222
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
23732256 |
ttttggtccctgcaaatatgtctcattttggtttt |
23732222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 24358872 - 24358838
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
24358872 |
ttttggtccctgcaaatatgtctcattttggtttt |
24358838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 24483401 - 24483451
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtc |
24483451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 25705376 - 25705342
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
25705376 |
ttttggtccctgcaaatatgtctcattttggtttt |
25705342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 29832088 - 29832042
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
29832088 |
ttgttgtttttggtccctgcaaaatattttgttttttaaaatagtcc |
29832042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 29859560 - 29859594
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29859560 |
ttttggtccctgcaaatatgtctcattttggtttt |
29859594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 30215495 - 30215529
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
30215495 |
ttttggtccctgcaaatatgtctcattttggtttt |
30215529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 344
Target Start/End: Original strand, 32691311 - 32691361
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
32691311 |
taggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcatttt |
337 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 40125039 - 40125073
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
40125039 |
ttttggtccctgcaaatatgtctcattttggtttt |
40125073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 42695941 - 42695975
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
42695941 |
ttttggtccctgcaaatatgtctcattttggtttt |
42695975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 44559336 - 44559302
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44559336 |
ttttggtccctgcaaatatgtctcattttggtttt |
44559302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 343
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 1497943 - 1497894
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||| ||| |||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtc |
1497894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 314 - 347
Target Start/End: Complemental strand, 22881950 - 22881917
Alignment:
| Q |
314 |
gtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtc |
22881917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 25299747 - 25299796
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtc |
25299796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 26707871 - 26707924
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
26707871 |
taggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtc |
26707924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 37911121 - 37911072
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || ||||||||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37911072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 16968555 - 16968603
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtc |
16968603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 31326253 - 31326201
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||| |||| ||||||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtc |
31326201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 35155620 - 35155568
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||| ||||| |||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtc |
35155568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 396
Target Start/End: Complemental strand, 39367694 - 39367658
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttg |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
39367694 |
ttgttgtttttggtccctgcaaaatattttgtttttg |
39367658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 315 - 343
Target Start/End: Original strand, 41451916 - 41451944
Alignment:
| Q |
315 |
tccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41451916 |
tccctgcaaatatgtctcattttggtttt |
41451944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 42358875 - 42358843
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaa |
324 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
42358875 |
attaggctaaaatatggttttagtccctgcaaa |
42358843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 144)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 31398542 - 31398490
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
31398490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 6412215 - 6412330
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
6412215 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
6412314 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6412315 |
tttttggaaatagtcc |
6412330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 11448536 - 11448588
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
11448588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 285 - 406
Target Start/End: Original strand, 21993776 - 21993899
Alignment:
| Q |
285 |
attaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaa |
382 |
Q |
| |
|
||||| || |||||||||||||| |||| |||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||| |
|
|
| T |
21993776 |
attaaataataggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
21993875 |
T |
 |
| Q |
383 |
atattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
21993876 |
atattttgtttttggaaatagtcc |
21993899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 292 - 347
Target Start/End: Complemental strand, 25431858 - 25431803
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25431858 |
attaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
25431803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 21385585 - 21385472
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttgtt |
21385486 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21385485 |
tttggaaatagtcc |
21385472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 30928680 - 30928732
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
30928732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 17765008 - 17765122
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct-tgt--nnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttgt |
17765107 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
17765108 |
ttttgaaaatagtcc |
17765122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 22543352 - 22543466
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc--ttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
22543352 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttgt |
22543451 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22543452 |
ttttggaaatagtcc |
22543466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 24901239 - 24901294
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcttgt |
351 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcttgt |
24901294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 30239293 - 30239344
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtc |
30239344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 30929044 - 30928993
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
30928993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 12176646 - 12176592
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12176646 |
ttaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
12176592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 19129523 - 19129469
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
19129523 |
ttaggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtc |
19129469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 22543721 - 22543667
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
22543721 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
22543667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 23770162 - 23770212
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
23770212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 5286949 - 5286900
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
5286900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 7156162 - 7156109
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7156109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 8170153 - 8170100
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 8680773 - 8680826
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8680773 |
taggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtc |
8680826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 10910966 - 10910913
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
10910966 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
10910913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 290 - 347
Target Start/End: Original strand, 14655373 - 14655430
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14655373 |
ttattaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
14655430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 23502541 - 23502492
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 24692981 - 24692928
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtc |
24692928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 293 - 345
Target Start/End: Original strand, 317809 - 317861
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag |
345 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
317809 |
ttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 3276355 - 3276303
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3276303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 3968644 - 3968696
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
3968696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 9896638 - 9896586
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
9896586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 12757609 - 12757661
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 15076205 - 15076153
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
15076153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 19690392 - 19690444
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
19690444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 21385250 - 21385302
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
21385302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 24274132 - 24274080
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
24274080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 33801744 - 33801692
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
33801692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 494405 - 494456
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
494456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 344
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 15962389 - 15962338
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
15962338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 20467720 - 20467606
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt--cttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| || |||||||||||| |||| ||||||||||||| |
|
|
| T |
20467720 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttgatccctgcaaaatattttgt |
20467621 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20467620 |
ttttggaaatagtcc |
20467606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 34582529 - 34582580
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
34582580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 289 - 347
Target Start/End: Complemental strand, 1215003 - 1214945
Alignment:
| Q |
289 |
attattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
1215003 |
attattaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtc |
1214945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 1890455 - 1890401
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
1890455 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
1890401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 406
Target Start/End: Original strand, 3414385 - 3414499
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgt |
3414484 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
3414485 |
ttttgaaaatagtcc |
3414499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 15962024 - 15962078
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
15962024 |
ttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
15962078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 18024378 - 18024324
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
18024378 |
ttaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtc |
18024324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 344
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 406
Target Start/End: Complemental strand, 19321134 - 19321020
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag-tcttgtnnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||| | ||| ||||||||||||||| | | ||||||||||| |
|
|
| T |
19321134 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgtaattttttttgttgtttttggtcgctgtaaaatattttgt |
19321035 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
19321034 |
ttttgaaaatagtcc |
19321020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 21994406 - 21994352
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21994406 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
21994352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 31166871 - 31166921
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
31166921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 34582895 - 34582841
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34582895 |
ttaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
34582841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 318099 - 318046
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
318099 |
taggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtc |
318046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 1007511 - 1007458
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1007511 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
1007458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 2615870 - 2615923
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
2615923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 3969011 - 3968958
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3969011 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
3968958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 9896280 - 9896329
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtc |
9896329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Complemental strand, 12299141 - 12299028
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttag-tcttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||| || ||| ||||||||| ||||||| ||||||||||||| | |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttctggtccctgcaaaatattttggt |
12299042 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
12299041 |
tttgaaaatagtcc |
12299028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 12419706 - 12419759
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
12419706 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
12419759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 12419940 - 12419887
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
12419940 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
12419887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 24901556 - 24901503
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| || ||||||||||||||| |
|
|
| T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtc |
24901503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 25137359 - 25137306
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25137359 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
25137306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 26375692 - 26375741
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 32885671 - 32885724
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
32885671 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtc |
32885724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 777676 - 777728
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtc |
777728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 1214695 - 1214747
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtc |
1214747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 3356141 - 3356193
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
3356193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 3356495 - 3356447
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3356447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 3414753 - 3414701
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
3414701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 7155796 - 7155848
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtc |
7155848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 8681117 - 8681065
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
8681065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 10091039 - 10091087
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
10091087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 11925739 - 11925791
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtct |
11925791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 14656261 - 14656209
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
14656209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 17765376 - 17765324
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtc |
17765324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 21995063 - 21995115
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtc |
21995115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 22792900 - 22792848
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtc |
22792848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 22822652 - 22822600
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
22822600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 26376042 - 26375994
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
26375994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 341
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtt |
341 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 347
Target Start/End: Original strand, 543365 - 543412
Alignment:
| Q |
300 |
aaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
543412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 293 - 348
Target Start/End: Complemental strand, 6564946 - 6564892
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6564946 |
ttaggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtct |
6564892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 17771911 - 17771962
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
17771962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 24273827 - 24273878
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
24273878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 31167200 - 31167149
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtc |
31167149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 31198615 - 31198666
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
31198666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 341
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
302 |
aatatgattttagtccctgcaaatatgtctcattttggtt |
341 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 344
Target Start/End: Complemental strand, 543726 - 543676
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta |
543676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 1007121 - 1007175
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
1007121 |
ttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
1007175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 3276091 - 3276137
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
3276091 |
ttgttgtttttggtccctgcaaaatattttgtttttgtaaatagtcc |
3276137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 12612362 - 12612308
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
12612362 |
ttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtc |
12612308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 14428651 - 14428701
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
14428701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 25121499 - 25121445
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||| || |||||||||||||| |
|
|
| T |
25121499 |
ttaggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtc |
25121445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 34989962 - 34990012
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtc |
34990012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 7324194 - 7324141
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
7324194 |
taggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
7324141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 13617531 - 13617580
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtc |
13617580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 360 - 405
Target Start/End: Complemental strand, 15443270 - 15443225
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
15443270 |
ttgttgtttttggtccctgcaaaatattttgtttttgaaaatagtc |
15443225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 21147402 - 21147455
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
21147402 |
taggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtc |
21147455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 23502236 - 23502289
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtct |
23502289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 292 - 337
Target Start/End: Complemental strand, 23770443 - 23770398
Alignment:
| Q |
292 |
attaggctaaaatatgattttagtccctgcaaatatgtctcatttt |
337 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
23770443 |
attaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 294 - 346
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| |||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 2373178 - 2373230
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtc |
2373230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 6412580 - 6412528
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtc |
6412528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 6468309 - 6468361
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtc |
6468361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 343
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 11449170 - 11449118
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||| ||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtc |
11449118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 12298825 - 12298873
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtc |
12298873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 12757936 - 12757888
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggtttta |
12757888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 13150751 - 13150699
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtc |
13150699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 13268108 - 13268160
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtc |
13268160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19267913 - 19267861
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| || |||| ||||||||| |||||||||||||||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtc |
19267861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 291 - 347
Target Start/End: Complemental strand, 21995430 - 21995374
Alignment:
| Q |
291 |
tattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||| ||| |||||| ||||||| |
|
|
| T |
21995430 |
tatttggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtc |
21995374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 25136993 - 25137045
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtc |
25137045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 290 - 346
Target Start/End: Original strand, 25431570 - 25431626
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||||||| || ||||| ||||||| |
|
|
| T |
25431570 |
ttataaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagt |
25431626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 33131851 - 33131799
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtc |
33131799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 33808619 - 33808671
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||| ||||| |||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtc |
33808671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 34990312 - 34990264
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
34990264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Complemental strand, 5286883 - 5286840
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
5286883 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
5286840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 10910629 - 10910680
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||| || |||||||||||| |||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtc |
10910680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Original strand, 15962096 - 15962139
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
15962096 |
ttgtttttggtccctgcaaaattttttgtttttggaaatagtcc |
15962139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 309 - 348
Target Start/End: Complemental strand, 19275223 - 19275184
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtct |
19275184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 346
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 363 - 406
Target Start/End: Complemental strand, 30038020 - 30037977
Alignment:
| Q |
363 |
ttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
30038020 |
ttgtttttggtccctgcaaaatattttgtttttgaaaatagtcc |
30037977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 406
Target Start/End: Complemental strand, 1007415 - 1007369
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||||| ||||||||| |
|
|
| T |
1007415 |
ttgttgtttttggtccctgtaaaatattttgcttttgaaaatagtcc |
1007369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 3968718 - 3968752
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
3968718 |
ttttggtccctgcaaatatgtctcattttggtttt |
3968752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 6412506 - 6412472
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
6412506 |
ttttggtccctgcaaatatgtctcattttggtttt |
6412472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 347
Target Start/End: Original strand, 6564595 - 6564633
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
6564633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 346
Target Start/End: Original strand, 15116670 - 15116721
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
15116670 |
ttaggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 19267841 - 19267807
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
19267841 |
ttttggtccctgcaaatatgtctcattttggtttt |
19267807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Original strand, 21385324 - 21385358
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
21385324 |
ttttggtccctgcaaatatgtctcattttggtttt |
21385358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 309 - 343
Target Start/End: Complemental strand, 22543645 - 22543611
Alignment:
| Q |
309 |
ttttagtccctgcaaatatgtctcattttggtttt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
22543645 |
ttttggtccctgcaaatatgtctcattttggtttt |
22543611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||| |||| |||||||||||||| | || |||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 25121182 - 25121235
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
25121182 |
taggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtct |
25121235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 14428948 - 14428899
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc |
14428899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 328
Target Start/End: Complemental strand, 15117041 - 15117008
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
15117041 |
aggctaaaatatggttttagtccctgcaaatatg |
15117008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 15722608 - 15722661
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||| ||||| |||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtc |
15722661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 19129334 - 19129387
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19129334 |
taggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtc |
19129387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 19276041 - 19275988
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
19276041 |
taggttaaaatatagttttagtccctacaaatatacctcattttggttttagtc |
19275988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 360 - 405
Target Start/End: Complemental strand, 30479356 - 30479311
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
30479356 |
ttgttgtttttggtccttgcaaaatattttgtttttgaaaatagtc |
30479311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 1890062 - 1890110
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||| ||||| |||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtc |
1890110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 294 - 346
Target Start/End: Complemental strand, 11926035 - 11925983
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| |||| ||| ||| ||||||||| | ||||||||||||| |
|
|
| T |
11926035 |
taggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 19296107 - 19296159
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtc |
19296159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 20467354 - 20467402
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtc |
20467402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 15013 - 14961
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtc |
14961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 14695 - 14748
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
14748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 406
Target Start/End: Original strand, 75356 - 75471
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttg |
390 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
75356 |
ttaggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
75455 |
T |
 |
| Q |
391 |
attttggaaatagtcc |
406 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
75456 |
tttttggaaatagtcc |
75471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 75767 - 75713
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
75767 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
75713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 47; Significance: 1e-17; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 4038 - 4092
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4038 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
4092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 293 - 347
Target Start/End: Original strand, 19220 - 19274
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19220 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 4289 - 4237
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
4237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19471 - 19419
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
19419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 1310 - 1362
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
1362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 1645 - 1593
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtc |
1593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 8546 - 8598
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
8598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 290 - 238
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 12525 - 12576
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
12576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 3532 - 3583
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
3583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 3919 - 3867
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtc |
3867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 12536 - 12485
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
12485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 12182 - 12233
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtc |
12233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 3294 - 3240
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
3294 |
ttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
3240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 27367 - 27313
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
27367 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
27313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 223175 - 223121
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
223175 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtc |
223121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 47924 - 47976
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
47976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 48228 - 48179
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtct |
48179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 346
Target Start/End: Original strand, 222817 - 222863
Alignment:
| Q |
300 |
aaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagt |
222863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 24370 - 24423
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24370 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtc |
24423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 2777 - 2829
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 8329 - 8381
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
8381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 8643 - 8591
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
8591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 5709 - 5657
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
5657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 5398 - 5451
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtct |
5451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 294 - 346
Target Start/End: Complemental strand, 10517 - 10465
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10517 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
10465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 10168 - 10219
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
10219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 366274 - 366222
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
366222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 365979 - 366030
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| ||| |||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtc |
366030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 406
Target Start/End: Complemental strand, 148282 - 148170
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgatt |
393 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||| ||||||||||| ||||||||||||| || |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttttttttggtcccagcaaaatattttgttt |
148183 |
T |
 |
| Q |
394 |
ttggaaatagtcc |
406 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
148182 |
ttgaaaatagtcc |
148170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 9028 - 8977
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
8977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 8734 - 8783
Alignment:
| Q |
298 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
8783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 16724 - 16775
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtc |
16775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 360 - 405
Target Start/End: Complemental strand, 17022 - 16977
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagtc |
405 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| ||||| |||||||| |
|
|
| T |
17022 |
ttgttgtttttggtccctgcaaaatatgttgtttttgaaaatagtc |
16977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 406
Target Start/End: Complemental strand, 82708 - 82594
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttga |
391 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| | ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
82708 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttgt |
82609 |
T |
 |
| Q |
392 |
ttttggaaatagtcc |
406 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
82608 |
ttttgaaaatagtcc |
82594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 82340 - 82392
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
82392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 5208 - 5257
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 5228 - 5277
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 406
Target Start/End: Original strand, 54814 - 54927
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||||||| | | |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattatttt |
54913 |
T |
 |
| Q |
393 |
tttggaaatagtcc |
406 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
54914 |
tttggaaatagtcc |
54927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 50075 - 50027
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
50027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 55176 - 55128
Alignment:
| Q |
299 |
taaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
55128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 4312 - 4261
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||| |||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtc |
4261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 303 - 347
Target Start/End: Original strand, 4016 - 4060
Alignment:
| Q |
303 |
atatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| ||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtc |
4060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 34931 - 34982
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtc |
34982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 284 - 347
Target Start/End: Complemental strand, 18055 - 17992
Alignment:
| Q |
284 |
aattaattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||| |||||| ||| |||||| ||||||| |
|
|
| T |
18055 |
aattattttttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtc |
17992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 2663 - 2609
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
2663 |
ttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtc |
2609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 346
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
346 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 4081 - 4027
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtct |
348 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
4081 |
taggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtct |
4027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 344
Target Start/End: Original strand, 94055 - 94105
Alignment:
| Q |
294 |
taggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
94055 |
taggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 344
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 328
Target Start/End: Original strand, 344928 - 344969
Alignment:
| Q |
287 |
taattattaggctaaaatatgattttagtccctgcaaatatg |
328 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
344928 |
taatcattaggctcaaatatgattttggtccctgcaaatatg |
344969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 7265 - 7216
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 17972 - 17915
Alignment:
| Q |
290 |
ttattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| ||| ||| ||||| |||| |
|
|
| T |
17972 |
ttatttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtc |
17915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 17651 - 17701
Alignment:
| Q |
297 |
gctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| |||| ||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtc |
17701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 288 - 347
Target Start/End: Original strand, 36757 - 36816
Alignment:
| Q |
288 |
aattattaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
36757 |
aattattaggcttaaatatgaaaatagtccctgcaaatatctgacattttggttttagtc |
36816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 2883 - 2832
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtc |
2832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 347
Target Start/End: Complemental strand, 35087 - 35033
Alignment:
| Q |
293 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
347 |
Q |
| |
|
||||||||||||||| |||| ||| | |||||||||||| |||||||||||||| |
|
|
| T |
35087 |
ttaggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtc |
35033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 404
Target Start/End: Original strand, 34787 - 34831
Alignment:
| Q |
360 |
ttgttgtttttggtccccgcaaaatattttgattttggaaatagt |
404 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
34787 |
ttgttgtttttggtccctgcaaaatattttacttttgaaaatagt |
34831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 402
Target Start/End: Complemental strand, 22056 - 21947
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt-cttgt-nnnnnnnnttgttgtttttggtccccgcaaaatattttgat |
392 |
Q |
| |
|
||||||||||||| |||| |||||| ||||| || ||| ||||||||||||| ||||| |||||||||||| |||| ||||||||||||| | |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatattttgtt |
21957 |
T |
 |
| Q |
393 |
tttggaaata |
402 |
Q |
| |
|
|||| ||||| |
|
|
| T |
21956 |
tttgaaaata |
21947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 327
Target Start/End: Complemental strand, 30976 - 30935
Alignment:
| Q |
286 |
ttaattattaggctaaaatatgattttagtccctgcaaatat |
327 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
30976 |
ttaattaataggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 189679 - 189630
Alignment:
| Q |
295 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
189679 |
aggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
296 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
344 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University