View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_58 (Length: 313)
Name: NF4445_high_58
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_58 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 75 - 313
Target Start/End: Original strand, 2830464 - 2830702
Alignment:
| Q |
75 |
tagtacgtaattaaggaatgctgcatgcatcaaaggtcttggaagcttgtgagttgtgactatgcagcttttgaatttattattcagaacccacgcgctt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2830464 |
tagtacgtaattaaggaatgctgcatgcatcaaaggtcttggaagcttgtgagttgtgactatgcagcttttgaatttattattcagaacccacgcgctt |
2830563 |
T |
 |
| Q |
175 |
gcatttatatcaagaatcaaaatggattgatcccacatttcttcttgaagaagttgccatataaaaccaagattgtttgttacacatatatgctattaac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2830564 |
gcatttatatcaagaatcaaaatggattgatcccacatttcttcttgaagaagttgccatataaaaccaagattgtttgttacacatatatgctattaac |
2830663 |
T |
 |
| Q |
275 |
cagggttttatttatgggtttttctatcatgtgcaaatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2830664 |
cagggttttatttatgggtttttctatcatgtacaaatt |
2830702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 2830273 - 2830334
Alignment:
| Q |
15 |
agacgaactgcaaaaatgtaggtcaagtcaagctatgtttatctacctactctctgttgata |
76 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
2830273 |
agactaactgcaaaaatgtaggtcaagtcaagctatgtttctctacctactctttgttgata |
2830334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 136 - 200
Target Start/End: Original strand, 7009702 - 7009766
Alignment:
| Q |
136 |
atgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatgga |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
7009702 |
atgcagcttttgaatttatttttcagaacccatgtgcttgcatttatatcaagaatcaaaatgga |
7009766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 94 - 123
Target Start/End: Original strand, 7009589 - 7009618
Alignment:
| Q |
94 |
gctgcatgcatcaaaggtcttggaagcttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7009589 |
gctgcatgcatcaaaggtcttggaagcttg |
7009618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 3561866 - 3561899
Alignment:
| Q |
280 |
ttttatttatgggtttttctatcatgtgcaaatt |
313 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
3561866 |
ttttttttatgggtttttctatcatgtgcaaatt |
3561899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Complemental strand, 29686510 - 29686477
Alignment:
| Q |
280 |
ttttatttatgggtttttctatcatgtgcaaatt |
313 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
29686510 |
ttttacttatgggtttttctatcatgtgcaaatt |
29686477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University