View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4445_high_82 (Length: 279)
Name: NF4445_high_82
Description: NF4445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4445_high_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 231655 - 231706
Alignment:
| Q |
163 |
catgcaactcttccattaacatatattgggcttcttcttcactgaagcctct |
214 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||| ||||||||||| |
|
|
| T |
231655 |
catgcaactcttccattaacacattttgggcttctctttcgctgaagcctct |
231706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 42
Target Start/End: Complemental strand, 232029 - 231998
Alignment:
| Q |
11 |
aatgaggaacattgatcttatcatagtctctc |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
232029 |
aatgaggaacattgatcttatcatagtctctc |
231998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 51
Target Start/End: Original strand, 46707465 - 46707502
Alignment:
| Q |
14 |
gaggaacattgatcttatcatagtctctctgcattata |
51 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
46707465 |
gaggaacattgattttatcatagtctttctgcattata |
46707502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 14 - 51
Target Start/End: Complemental strand, 25329935 - 25329898
Alignment:
| Q |
14 |
gaggaacattgatcttatcatagtctctctgcattata |
51 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
25329935 |
gaggaacattgattttatcatagtctctctacattata |
25329898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University